-
Plasmid#217373PurposesfGFP reporter for Bsu pbuE* 2AP riboswitchDepositorInsertPca rhtB riboswitch sfGFP reporter
UseTagsExpressionMutationPromoterAvailable sinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FLVCR1_STOP
Plasmid#161058PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertFLVCR1 (FLVCR1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_FLVCR1
Plasmid#131892PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertFLVCR1 (FLVCR1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCNICK
Plasmid#84653PurposeGenome editing for Lactobacillus casei Lc2WDepositorInsertsCas9 nickase
sgRNA
homology arms of LC2W_2179
UseCRISPRTagsExpressionMutationD10APromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPRmTmG2
Plasmid#69992PurposeThe CRISPR construct targets near the LoxP sites in Rosa-pCA-loxP-mTdtomato-loxP-mEGFP mice.DepositorInsertgRNA that targets near LoxP sites
UseTagsExpressionMutationPromoterAvailable sinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHSP02
Plasmid#117259PurposeGenome editing for Lactobacillus plantarum WCSF1DepositorInsertCas9, promotor P11-guide-RNA, homologous arms of Lp_0537
UseOtherTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHSB04X
Plasmid#117258PurposeGenome editing for Lactobacillus brevis ATCC367DepositorInsertCas9, promotor PslpA-guide-RNA, homologous arms of Lb_1019
UseOtherTagsExpressionMutationPromoterAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKB12 (pDEST-DHFR F[3] C-term, HygR)
Plasmid#210486PurposepDEST vector to tag gene of interest with DHFR F[3] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…TagsExpressionYeastMutationPromoterADH1Available sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…TagsExpressionYeastMutationPromoterADH1Available sinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…TagsExpressionYeastMutationPromoterADH1Available sinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…TagsExpressionYeastMutationPromoterADH1Available sinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC45A3
Plasmid#132167PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC45A3 (SLC45A3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC45A3_STOP
Plasmid#161333PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC45A3 (SLC45A3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
UseTagsExpressionMammalianMutationPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG431
Plasmid#165615PurposeVector for expression of SpCas9 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-CYC1t (S. cerevisiae TEF promoter driving SpCas9 with KanR cassette replacing PID)
UseCRISPRTagsSV40 NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG442
Plasmid#165616PurposeVector for expression of SpCas9-Zif268 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t
UseCRISPRTags3x HA, SV40 NLS, Zif268, and c-Myc-like NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1b
Plasmid#218535Purposehuman FLVCR1b cDNADepositorInsertFLVCR1 (FLVCR1 Human)
UseRetroviralTagsExpressionMammalianMutationAlternative isoformPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1/FLVCR1a
Plasmid#218533Purposehuman FLVCR1/FLVCR1a cDNADepositorInsertFLVCR1 (FLVCR1 Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro FLVCR1_sg5
Plasmid#218522PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v1 GFP FLVCR1_sg5
Plasmid#218521PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only