-
Plasmid#193208PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col22a1 geneDepositorInsertsgCol22a1#2 (Col22a1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAdgb#1/Cre
Plasmid#193200PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Adgb geneDepositorInsertsgAdgb#1 (Adgb Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMroh2b#2/Cre
Plasmid#193220PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Mroh2b geneDepositorInsertsgMroh2b#2 (Heatr7b2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#2/Cre
Plasmid#193222PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorInsertsgNkx2-1#2 (Nkx2-1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAdgb#2/Cre
Plasmid#193201PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Adgb geneDepositorInsertsgAdgb#2 (Adgb Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCol22a1#1/Cre
Plasmid#193207PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col22a1 geneDepositorInsertsgCol22a1#1 (Col22a1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMroh2b#1/Cre
Plasmid#193219PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Mroh2b geneDepositorInsertsgMroh2b#1 (Heatr7b2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCBh_NLS_dCas13X_NLS-pA-U6-DR-BpiI-BpiI-DR-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#191796Purposevector for encoding a human codon-optimized dead Cas13X (dCas13X) driven by CBh promoter, guide RNAs compatible with Cas13X driven by hU6, EGFP driven by SV40 promoter, and mCherry driven by SV40 promoterDepositorInserthumanized dCas13X
UseCRISPRTagsExpressionMammalianMutationR84A, H89A, R739A, R740A, H745A, H746A, H747APromoterCBh, SV40, hU6Available sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMB4
Plasmid#122246PurposeLentivirus delivery for stable expression of As crRNA, has AsDR; Cloning vector for expression of AsCpf1 crRNA. It contains BsmBI site for cloning.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFTK087
Plasmid#171359PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertP-ANtRNA[Pro1]-sgRNA-dummy-Esp3I, Pol-III sgRNA-plug-in transcription unit
UseSynthetic BiologyTagsExpressionBacterial and YeastMutationn/aPromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK093
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyTagsExpressionBacterial and YeastMutationn/aPromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMB30
Plasmid#122247PurposeLentivirus delivery for stable expression of Lb crRNA, has LbDR; Cloning vector for expression of LbCas12a crRNA. It contains BsmBI site for cloning.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFTK086
Plasmid#171358PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertP-ANtRNA[Arg21]-sgRNA-dummy-Esp3I, Pol-III sgRNA-plug-in transcription unit
UseSynthetic BiologyTagsExpressionBacterial and YeastMutationn/aPromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW299-lenti-spsgRNA-Esp3I-2kb-filler-pEF1s-NLS-tagBFP-P2A-BlastR
Plasmid#189943PurposeLentiviral vector to co-express an spsgRNA with NLS-tagBFPDepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
UseTagsExpressionMammalianMutationPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
gGBEv6.3-SpCas9
Plasmid#202629Purposevector for encoding an engineered glycosylase-based guanine base editor (gGBEv6.3) with SpCas9 nickase driven by EF1a promoter, guide RNA compatible with SpCas9 driven by hU6, mCherry driven by CBh promoterDepositorInsertnSpCas9(D10A)-MPGv6.3
UseTagsExpressionMammalianMutationMPGv6.3 = G163R, N169G, D175R, C178N, S198A, K202…PromoterhU6, EF1a, CBhAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi
Plasmid#138106PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas12Max
Plasmid#195334Purposevector for encoding a human codon-optimized Cas12Max driven by CBh promoter, guide RNAs compatible with xCas12i driven by hU6, and mCherry driven by CMV promoterDepositorInserthuman codon-optimized Cas12Max
UseTags3xFlagExpressionMammalianMutationN243RPromoterCBh, CMV, hU6Available sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only