167,150 results
-
Plasmid#190663PurposeKanamycin resistance donor for N7HELIX containing 14bp of spacing between the I-AniI site and LE/RE using ShCAST flanking sequenceDepositorInsertKanR, R6K origin of replication
ExpressionBacterialPromoterNAAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLI50
Plasmid#13573DepositorTypeEmpty backboneUseS. aureus-e. coli shuttle vectorAvailable SinceJan. 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA050
Plasmid#216107PurposegDNA expression for Cas9 with ChenF+E trRNA (guide only)DepositorInsertgDNA expression for Cas9 with ChenF+E trRNA
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTUB1:YFP-mAID-3HA, DHFR-TS:HXGPRT
Plasmid#87259PurposeYFP-mAID-3HA fusion driven by a minimal TUB1 promoter with an HXGdrug selectable marker. The mAID CDS is from Arabidopsis thaliana auxin-responsive protein IAA17E66-S133DepositorInsertsYFP-mAID-3HA
HXGPRT
UseToxoplasma expressionTags3HA and mAIDMutationCodon optimized for Toxoplasma gondii expressionPromoterTgDHFR-TS 463 bp and TgTUB1 378 bpAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
wtTDP43tdTOMATOHA
Plasmid#28205DepositorAvailable SinceJune 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCas9-sgAAVS1-1
Plasmid#129726PurposeExpressing SpCas9 and sgAAVS1-1DepositorInsertSpCas9 and sgAAVS1-1
UseCRISPRTagsP2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR
Plasmid#42875PurposeA crRNA expression plasmid for targeting a specific sequence.DepositorInsertCRISPR-BsaI
UseCRISPR; E.coliExpressionBacterialAvailable SinceMarch 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga11
Plasmid#196059PurposeEncodes a G alpha subunit (GNA11) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple GaoB
Plasmid#196052PurposeEncodes a G alpha subunit (GNAO1 Isoform Alpha 2) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensorDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMVtight Puro DEST (w768-1)
Plasmid#26430DepositorTypeEmpty backboneUseLentiviral; Tet-on advanced destination vectorExpressionMammalianAvailable SinceDec. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCE-hOCT3/4
Plasmid#41813PurposeNon-integrating (episomal) expression of human OCT3/4DepositorAvailable SinceApril 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2A
Plasmid#224440PurposeRep/Cap plasmid for the production of MyoAAV 2A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDQTTL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLDPuro-hsnSR100N
Plasmid#35172DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SynB
Plasmid#174861PurposeExpresses mouse syncytin B in mammalian cellsDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMG-GRIS
Plasmid#225134PurposeFor genome editing in P. putida KT2440, rhamnose is used for the induction of I-sceI gene. Gm.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceOct. 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDEST53-LRRK2-WT
Plasmid#25044DepositorAvailable SinceJune 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMK348 (BSD-P2A-mAID-mClover)
Plasmid#121182PurposeN-terminal taggingDepositorInsertBSD-P2A-mAID-mClover
UseCRISPRAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS307
Plasmid#51785Purposean integrating (YIp) vector with a LYS2 selectable markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_[Cox8a]x2_HaloTag9
Plasmid#175539PurposeExpression of HaloTag9 at the inner membrane of mitochondria in mammalian cellsDepositorInsertCox8a-HaloTag9
ExpressionMammalianMutationHaloTag9 = HaloTag7-Q165H-P174RAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-UniSAM
Plasmid#99866PurposeEncodes for Cas9-VP64, MS2-p65-HSF1, mCherry and for the gRNA 2.0DepositorInsertUniSAM-mCherry + U6-gRNA2.0
UseCRISPR and Synthetic Biology; Dcas9-sam activationExpressionMammalianMutationBbsI sites in CDS were ablated by consensus mutat…PromoterEF1aAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHD-DsRed
Plasmid#51434PurposeVector for generating dsDNA donors for homology-directed repair. Contains the visible marker 3xP3-DsRed.DepositorInsertLoxP-3xP3-DsRed-LoxP
Promoter3xP3Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
SRE reporter vector_559
Plasmid#82686PurposeCloning vector containing serum response element (SRE) followed by an AscI restriction siteDepositorTypeEmpty backboneExpressionMammalianAvailable SinceNov. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pN7CAST
Plasmid#190661PurposeExpresses polycistronic N7 CAST where Cas12k-T2A-TnsC and TniQ-T2A-TnsB are separated by an EMCV IRESDepositorInserthuman codon optimized N7Cas12k, N7TnsC, N7TniQ, N7TnsB
ExpressionMammalianPromoterCMVAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG PSAM4 GlyR IRES EGFP
Plasmid#119739PurposeChemogenetic inhibitor expression plasmidDepositorInsertPSAM4 GlyR IRES eGFP (CHRNA7 Synthetic, Human)
ExpressionMammalianMutationL131G, Q139L, Y217FPromoterCAGAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
HotPETase_pET21b
Plasmid#215407PurposeExpression construct for HotPETase gene, codon optimized for expression in E. coliDepositorInsertHotPETase
ExpressionBacterialMutationS121E/D186H/R280A/P181V/S207R/S214Y/Q119K/S213E/N…Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p-EF1a-CreERT2-3Xflag-T2A-eBFP2
Plasmid#170186PurposeThis Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracingDepositorInsertCreERT2-T2A-eBFP2
UseLentiviralPromoterEF1 alphaAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX_DSB_Spectrum-V2
Plasmid#192475PurposeLentiviral DSB Spectrum V2 Reporter SystemDepositorInsertBFP1.2, incompleteGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-goldDn29-P2A-GFP
Plasmid#247153PurposeMammalian expression of a human codon optimized engineered goldDn29 recombinase (efficient and specific variant)DepositorInsertgoldDn29-P2A-GFP
Tags6xHisExpressionMammalianMutationM6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503NPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE57
Plasmid#90402PurposeType I Interferon - ISGF3G (STAT1, STAT2, IRF9) gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterISREAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only