-
Plasmid#124814PurposeHighly resposive GFP-based pyruvate nanosensor with a nuclear localization signal.DepositorInsertPyronicSF
UseTagsNuclear Localization SignalExpressionMammalianMutationPromoterCMVAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDUET-1-alpha-synuclein-mCerulean3-His6
Plasmid#110061PurposeFor bacterial expression of human alpha-synuclein, carboxyl terminally tagged with mCerulean3 and poly-histidinesDepositorInsertalpha-synuclein (SNCA Human)
UseTags6 x His and mCerulean3ExpressionBacterialMutationPromoterT7Available sinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 WT KSR1
Plasmid#25970DepositorInsertKinase suppressor of Ras 1 (Ksr1 Mouse)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceAug. 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-K41M-S285A-T289A-3xFLAG
Plasmid#69842PurposeThis plasmid encodes kinase dead PLK4 isoform 1 carrying K41M and S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
UseTags3xFLAG tag and EGFPExpressionMammalianMutationK41M-S285A-T289APromoterCMVAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPW3763 : CMVd3-HsIRE1dLKR-HaloTag
Plasmid#185685PurposeLow-level transient expression of HsIRE1 lacking the linker, kinase, and RNase domains, with a C-terminal HaloTag.DepositorInsertERN1 (ERN1 Synthetic, Human)
UseTagsHaloTagExpressionMammalianMutationDeletion of linker, kinase, and Rnase domainsPromoterAvailable sinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
UseTagsGST TagExpressionInsectMutationPromoterPHAvailable sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-6His-Nter-GWs-Lox (VE5587)
Plasmid#163768PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 6 His tag under the pH promoter.DepositorInsertN-terminal 6His tag
UseTags6 His TagExpressionInsectMutationPromoterPHAvailable sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-10His-Cter (VE5631)
Plasmid#161802PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter10His tag under the p10 promoter.DepositorInsertC-terminal 10 His tag
UseTags10 HisExpressionInsectMutationPromoterp10Available sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-P10-mCherry-pH-3C-TwinStrep (VE5621)
Plasmid#139770PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter TwinStrep tag under the PH promoter.DepositorInsertC-terminal TwinStrep tag
UseTags3C - TwinStrep tagExpressionMutationPromoterPHAvailable sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-10His-Cter (VE5742)
Plasmid#139776PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter10His tag under the pH promoter.DepositorInsertC-terminal 10His tag
UseTags10 HisExpressionInsectMutationPromoterPHAvailable sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-Flag-Cter(VE5738)
Plasmid#161798PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter Flag tag under the p10 promoter.DepositorInsertC-terminal Flag tag
UseTagsFlagExpressionInsectMutationPromoterp10Available sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-10His-Nter-GWs-Lox (VE5588)
Plasmid#161806PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 10 His tag under the pH promoter.DepositorInsertN-terminal 10His tag
UseTags10 HisExpressionInsectMutationPromoterPHAvailable sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 N539
Plasmid#25972DepositorInsertKinase suppressor of Ras 1 (Ksr1 Mouse)
UseTagsFlagExpressionMammalianMutationDeleted amino acids 540-873PromoterAvailable sinceAug. 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 C540
Plasmid#25971DepositorInsertKinase suppressor of Ras 1 (Ksr1 Mouse)
UseTagsFlagExpressionMammalianMutationDeletes amino acids 1-539PromoterAvailable sinceAug. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.3 (19-361)
Plasmid#177846PurposeBacterial Expression of SnRK2.3DepositorInsertSNF1-related protein kinase 2.3 (SNRK2.3 Mustard Weed)
UseTags6xHis-SUMOExpressionBacterialMutationPromoterAvailable sinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral N
Plasmid#113009PurposeFor bacterial expression of MBP fusion of N terminal region of Drosophila TralDepositorInsertN terminus of tral (tral Fly)
UseTagsExpressionBacterialMutationamino acids 1-355PromoterAvailable sinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C
Plasmid#113008PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila TralDepositorInsertC terminus of tral (tral Fly)
UseTagsExpressionBacterialMutationamino acids 356-652PromoterAvailable sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only