-
Plasmid#172846PurposeCRISPIE donor B5 (Zhong et al, eLife 2021), CDS of VCL exon21-mEGFP, translational phase (0-stop), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-stop) encoding the CDS of VCL exon 21 fused to mEGFP
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC43
Plasmid#66565PurposesgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 2XPP7
PCP-VP64 IRES mCherry
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-pegSERPINA1-U6-Nicking-PE2-N
Plasmid#164907PurposeExpress a pegRNA targeting SERPINA1, and a nicking sgRNA and the N-terminal split-intein fragment of PE2DepositorInsertpegSERPINA1, Nicking sgRNA, PE2-N
UseAAVTagsExpressionMutationPromoterAvailable sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_1
Plasmid#138324PurposeExpress guide RNA 2 for mouse MycDepositorInsertcMyc sgRNA (Myc Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.PAC
Plasmid#57829PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-PAC
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGPT2_5
Plasmid#163455Purposelentiviral vector expressing Cas9 and an sgRNA targeting GPT2DepositorInsertsgRNA 5 targeting GPT2 (GPT2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-Gsk3b(new)
Plasmid#122341PurposeExpresses sgRNA targeting mouse Gsk3b and eSpCas9 in mammalian cellsDepositorInsertsgRNA for mouse Gsk3b
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_2
Plasmid#138346PurposeExpress guide RNA 1 for mouse MycDepositorInsertcMyc sgRNA (Myc Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgNeg1
Plasmid#166998PurposeLentiviral expression of negative control sgRNA for CRISPRi knockdownDepositorInsertNegative control sgRNA 1
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 stuffer v3
Plasmid#158046Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA casette (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Tol2-LyzC-GFP-U6ac-rac2-guides
Plasmid#168241Purpose"neutrophil specific GFP with ubiquitous rac2 sgRNAs"DepositorInsertrac2 sgRNAs
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330-GAPDH
Plasmid#136940PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4DepositorInsertsgRNA targeting GAPDH (GAPDH Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9-HF1
Plasmid#92115PurposeExpression plasmid for human codon-optimized dead/inactive high-fidelity SpCas9-HF1 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9-HF1 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, Q926APromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLC-EGFP-RIP1
Plasmid#75163PurposeLentiCRISPR-EGFP with sgRNA targeting human RIPk1DepositorInsertRIPK1 sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
Plasmid#140205PurposeProof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.DepositorInsertsmCherry
sgRNA E1
UseCRISPR and Synthetic Biology; Proof-of-concept te…TagsExpressionMutationG174DPromoterPelcA and U3Available sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC42
Plasmid#66564PurposesgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 1XPP7
PCP-VP64 IRES mCherry
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only