33,073 results
-
Plasmid#187219PurposeExpresses Eco1 ncRNA v35 (long a1/a2) and Eco1 ncRNA v35 (long a1/a2, barcode 6) from promoters pTet* and pBetI, respectivelyDepositorInsertA: Retron Eco1 ncRNA v35 (long a1/a2); B: Retron Eco1 ncRNA v35 (long a1/a2, barcode 6)
UseSynthetic BiologyExpressionBacterialPromoterA: pTet*; B: pBetIAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSelect-6
Plasmid#190243PurposeEncodes lacI- and GFP-targeting gRNAs for positive and negative selections of dCas9 activity.DepositorInsertLacI
ExpressionBacterialAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-chi28TAG
Plasmid#188984PurposeExpress chimadanin with TAG at 28 positionDepositorInsertChimadanin with TAG at 28 position
ExpressionBacterialAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCSGC-GB1
Plasmid#186786PurposeE. coli expression vector containing N-terminal 6His-GB1-TEV fusion.DepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB167
Plasmid#101672PurposeOpto-T7RNAP*(563), equal expr.DepositorInsertOpto-T7RNAP*(563), equal expr.
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB152
Plasmid#101663PurposeOpto-T7RNAP*(563-F2)DepositorInsertOpto-T7RNAP*(563-F2)
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB147
Plasmid#101662PurposeOpto-T7RNAP*(302)DepositorInsertOpto-T7RNAP*(302)
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB164
Plasmid#101667PurposeOpto-T7RNAP*(563), half expr.DepositorInsertOpto-T7RNAP*(563), half expr.
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA02
Plasmid#172193PurposeSuicide vector carrying the site attL of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattL
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA03
Plasmid#172194PurposeSuicide vector carrying the site attR of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattR
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE80_T5_P9-ehaA_LacI
Plasmid#186317PurposePlasmid for inducible E coli expression of the P9 helixCAM.DepositorInsertP9-ehaA
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD_mCherry_GFP_-+
Plasmid#187390Purposearabinose-inducible expression of GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD_GFP_mCherry_++
Plasmid#187391Purposearabinose-inducible expression of GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE1059
Plasmid#186628PurposeExpression of S. coelicolor butyrolactone biosynthesis genes in E. coli. Heterologous production of SCBs.DepositorInsertsscbA
scbB
scbC
UseSynthetic BiologyTags6xHis and 6xHis-thrombinExpressionBacterialPromoterSynthetic promoter B10, Synthetic promoter B19, a…Available SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS009
Plasmid#188332PurposePCR template for repair templates to tag a gene with a mKate2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mKate2::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS003
Plasmid#188326PurposePCR template for repair templates to tag a gene with a mCherry and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mCherry::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA1018
Plasmid#189587PurposeT4wtGT7 deletion HR vector 250bp HR Arms (T4 phage editing)DepositorInsertT4wtGT7 Deletion Locus 250bp Homology Arms
UseSynthetic BiologyExpressionBacterialMutationEncodes for a full deletion of T4 from 52.1 (part…Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFPV25.1_dGFPmut3-AAV
Plasmid#187377PurposerpsM promoter driving the expression of destabilized GFPmut3 (containing a AAV C-terminal tail)DepositorInsertdGFPmut3_AAV
TagsAAVExpressionBacterialMutationC-terminal AAV tailAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHisIHFαIHFβ
Plasmid#149384PurposeExpression of P. aeruginosa PA14, 6xHis-HRV3C-IHFalpha and IHFbetaDepositorInsertsPseudomonas aeruginosa PA14 6xHis-tagged IHFalpha
Pseudomonas aeruginosa PA14 IHFbeta
Tags6xHis tag and HRV3C cleavage siteExpressionBacterialPromoterT7Available SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only