Showing: 1 - 20 of 212 results
-
Plasmid#64736PurposeYeast expression plasmidDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
-
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailabilityAcademic Institutions and Nonprofits only -
pARA (pKD-G1)
Plasmid#62680PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123
UseRNAiTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCEV-G1-Km
Plasmid#46813PurposeTEF1 and PGK1 promoter controlled expression cassettes with G418 resistance for yeast transformationDepositorTypeEmpty backboneUseTagsFLAG and c-mycExpressionYeastMutationPromoterTEF1 and PGK1AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G1-Ph
Plasmid#46814PurposeTEF1 and PGK1 promoter controlled expression cassettes with phleomycin resistance for yeast transformationDepositorTypeEmpty backboneUseTagsFLAG and c-mycExpressionYeastMutationPromoterTEF1 and PGK1AvailabilityAcademic Institutions and Nonprofits only -
G1S-HA-pCB6
Plasmid#74373PurposeMammalian expression of a G1S mutant HA from the X:31 strain of influenza virusDepositorInsertHA
UseTagsExpressionMammalianMutationG1SPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g1
Plasmid#120209PurposeCENPB CRISPRi guide RNA 1DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g1
Plasmid#80784PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 1/11/21 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pX-EGFP-g1
Plasmid#107273PurposeeGFP sgRNA-1 and Cas9 expression vector (aka. pX-ps1)DepositorInsertGFP sgRNA-1
UseCRISPRTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pAS_FLAG-G1 PylRS
Plasmid#154763Purposeplasmid with G1 PylRS for amber suppression in transient or stable, piggybac-mediated, integrationDepositorInsertG1 PylRS (MJ_RS07805 methanogenic archaeon mixed culture ISO4-G1)
UseTagsFLAGExpressionMammalianMutationPromoterEF1AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g1 + Cas9
Plasmid#153011PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorUseCRISPR and LentiviralTagsTagBFP2ExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g1 + Cas9
Plasmid#153015PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorHas ServiceLentiviral PrepInsertCas9 + TMPRSS2 gRNA
UseCRISPR and LentiviralTagsTagBFP2ExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
ACE2 g1 + Cas9 (Lentiviral Prep)
Viral Prep#153011-LVPurposeReady-to-use Lentiviral Prep particles produced from ACE2 g1 + Cas9 (#153011). In addition to the viral particles, you will also receive purified ACE2 g1 + Cas9 plasmid DNA. Lentiviral particles carrying a guide RNA targeting ACE2 and co-expressing Cas9 and TagBFP2.DepositorPromoterTagsNoneAvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g1 + Cas9 (Lentiviral Prep)
Viral Prep#153015-LVPurposeReady-to-use Lentiviral Prep particles produced from TMPRSS2 g1 + Cas9 (#153015). In addition to the viral particles, you will also receive purified TMPRSS2 g1 + Cas9 plasmid DNA. Lentiviral particles carrying a guide RNA targeting TMPRSS2 and co-expressing Cas9 and TagBFP2.DepositorPromoterTagsNoneAvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-POLB-KO-g1
Plasmid#176090PurposeCas9 plus POLB gRNA #1; contains a puromycin resistance cassetteDepositorInsertPOLB sgRNA #1 (POLB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(7FTrp)RS
Plasmid#177310PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 7-Fluoro-L-Tryptophan (7FTrp) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
UseTagsExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(7AW)RS
Plasmid#207516PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 7-Aza-L-Tryptophan (7AW) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
UseTagsExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
TMEM165 g1 LentiCRISPRv2-mCherry
Plasmid#218660PurposeKnockout vector for human TMEM165DepositorInsertTMEM165 (TMEM165 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorInsertGOLIM4 (GOLIM4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
PB-EEA-g1-PGK-Puro
Plasmid#102908PurposePiggyBac transposon system construct for U6 promoter-driven expression of a gRNA targeting EEA-motif. Includes PGK-puro selection cassette.DepositorInsertEEA-guide1-PGK-Puro
UseCRISPRTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only
Showing: 1 - 20 of 212 results