pLentiCRISPRv2-POLB-KO-g1
(Plasmid
#176090)
-
PurposeCas9 plus POLB gRNA #1; contains a puromycin resistance cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentivirus
- Total vector size (bp) 13013
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePOLB sgRNA #1
-
gRNA/shRNA sequenceGAGCAAACGGAAGGCGCCGC
-
SpeciesH. sapiens (human)
-
Entrez GenePOLB
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BSMBI (destroyed during cloning)
- 5′ sequencing primer N/A (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2-POLB-KO-g1 was a gift from Robert Sobol (Addgene plasmid # 176090 ; http://n2t.net/addgene:176090 ; RRID:Addgene_176090) -
For your References section:
Temporal dynamics of base excision/single-strand break repair protein complex assembly/disassembly are modulated by the PARP/NAD(+)/SIRT6 axis. Koczor CA, Saville KM, Andrews JF, Clark J, Fang Q, Li J, Al-Rahahleh RQ, Ibrahim M, McClellan S, Makarov MV, Migaud ME, Sobol RW. Cell Rep. 2021 Nov 2;37(5):109917. doi: 10.1016/j.celrep.2021.109917. 10.1016/j.celrep.2021.109917 PubMed 34731617