Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiCRISPRv2-POLB-KO-g1
(Plasmid #176090)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176090 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Lentivirus
  • Total vector size (bp) 13013
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POLB sgRNA #1
  • gRNA/shRNA sequence
    GAGCAAACGGAAGGCGCCGC
  • Species
    H. sapiens (human)
  • Entrez Gene
    POLB

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BSMBI (destroyed during cloning)
  • 5′ sequencing primer N/A
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2-POLB-KO-g1 was a gift from Robert Sobol (Addgene plasmid # 176090 ; http://n2t.net/addgene:176090 ; RRID:Addgene_176090)
  • For your References section:

    Temporal dynamics of base excision/single-strand break repair protein complex assembly/disassembly are modulated by the PARP/NAD(+)/SIRT6 axis. Koczor CA, Saville KM, Andrews JF, Clark J, Fang Q, Li J, Al-Rahahleh RQ, Ibrahim M, McClellan S, Makarov MV, Migaud ME, Sobol RW. Cell Rep. 2021 Nov 2;37(5):109917. doi: 10.1016/j.celrep.2021.109917. 10.1016/j.celrep.2021.109917 PubMed 34731617