We narrowed to 86,032 results for: plasmid
-
Plasmid#26972PurposeAAV expression of eNpHR 3.0 fused to EYFP driven by humanized Synapsin promoter for optogenetic inhibitionDepositorHas serviceAAV2 and AAV5InserteNpHR 3.0
UseAAVTagsEYFPExpressionMammalianMutationTrafficking Signal (TS) ER Export SignalPromoterhSynAvailable sinceFeb. 4, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMAZ-SK
Plasmid#73962Purposeself-killing gRNA plasmid pMAZ-SKDepositorInsertgRNA
ExpressionBacterialPromoterpTetAvailable sinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-TREtight-mTagBFP2-B19G (AAV1)
Viral prep#100799-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-TREtight-mTagBFP2-B19G (#100799). In addition to the viral particles, you will also receive purified pAAV-TREtight-mTagBFP2-B19G plasmid DNA. Helper virus for monosynaptic tracing with rabies virus; to be coinjected with pAAV-syn-FLEX-splitTVA-EGFP-tTA (Addgene# 100798). These AAV preparations are suitable purity for injection into animals.DepositorPromoterTREtightTagsBFP (in presence of Cre and 100798)Available sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry
Plasmid#50459PurposeDouble floxed mCherry under the control of human synapsin promoterDepositorHas serviceAAV1, AAV2, AAV5, AAV8, AAV9, and AAV RetrogradeInsertmCherry
UseAAVTagsN/APromoterhuman Synapsin 1Available sinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pgRNA-bacteria
Plasmid#44251PurposeExpression of customizable guide RNA (gRNA) for bacterial gene knockdownDepositorInsertguide RNA (bacteria)
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available sinceApril 5, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PG13-luc (wt p53 binding sites)
Plasmid#16442PurposeLuciferase reporter containing 13 copies of the p53-binding consensus sequenceDepositorPublicationAvailable sinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (AAV1)
Viral prep#104493-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (#104493). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7b-WPRE plasmid DNA. Synapsin-driven, Cre-dependent jGCaMP7b expression. jGCaMP7b exhibits the brightest resting fluorescence and can be used for imaging of small neuronal processes (dendrites and axons). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (AAV Retrograde)
Viral prep#104492-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (#104492). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7f-WPRE plasmid DNA. Syn-driven, Cre-dependent GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons.DepositorPromoterSynAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICE-HA-MRE11-WT
Plasmid#82033PurposePlasmid for constitutive or doxycycline-inducible expression of wild-type human MRE11. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorAvailable sinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pICE-HA-MRE11-WT
Plasmid#82033PurposePlasmid for constitutive or doxycycline-inducible expression of wild-type human MRE11. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorAvailable sinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-OptoSTIM1
Plasmid#70159PurposeMammalian expression plasmid of OptoSTIM1 (optogenetically-activated STIM1 protein)DepositorAvailable sinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-OptoSTIM1
Plasmid#70159PurposeMammalian expression plasmid of OptoSTIM1 (optogenetically-activated STIM1 protein)DepositorAvailable sinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-hSyn-GRAB-gDA3m (AAV1)
Viral prep#208698-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB-gDA3m (#208698). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB-gDA3m plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent dopamine (DA) sensor GRAB_gDA3m in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562)
Plasmid#140002PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpG=D1135L/S1136W/G1218K/E1219Q/R13…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiPGK Puro DEST p38KTRClover
Plasmid#59152PurposeLentiviral vector to express p38 KTR mClover under PGK promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Human, Mouse)
UseLentiviralExpressionMammalianPromoterPGKAvailable sinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiPGK Puro DEST p38KTRClover
Plasmid#59152PurposeLentiviral vector to express p38 KTR mClover under PGK promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Mouse, Human)
UseLentiviralExpressionMammalianPromoterPGKAvailable sinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLM3705
Plasmid#47754PurposeExpresses mammalian cell codon-optimized dCas9-VP64DepositorInsertcodon optimized dCas9-VP64
UseCRISPRTags3x FLAG, NLS, and VP64ExpressionMammalianMutationD10A and H840A mutations in Cas9 (catalytically i…PromoterCMVAvailable sinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLM3705
Plasmid#47754PurposeExpresses mammalian cell codon-optimized dCas9-VP64DepositorInsertcodon optimized dCas9-VP64
UseCRISPRTags3x FLAG, NLS, and VP64ExpressionMammalianMutationD10A and H840A mutations in Cas9 (catalytically i…PromoterCMVAvailable sinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CaMKIIa-eNpHR 3.0-EYFP
Plasmid#26971PurposeAAV expression of eNpHR 3.0 fused to EYFP driven by CaMKIIa promoter for optogenetic inhibitionDepositorHas serviceAAV1 and AAV9InserteNpHR 3.0
UseAAVTagsEYFPExpressionMammalianMutationTrafficking Signal (TS) ER Export SignalPromoterCaMKIIaAvailable sinceFeb. 4, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by