268,286 results
-
Viral Prep#87306-AAV9PurposeReady-to-use AAV9 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro
Plasmid#71236PurposeExpress sgRNA and dCas9-KRAB from lentiviral vectorDepositorInsertshumanized dCas9-KRAB T2A Puro
sgRNA
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro
Plasmid#71236PurposeExpress sgRNA and dCas9-KRAB from lentiviral vectorDepositorInsertshumanized dCas9-KRAB T2A Puro
sgRNA
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiFUCCI(CA)5
Plasmid#223176PurposeLentiviral fluorescent ubiquitination-based cell cycle indicator (FUCCI)DepositorInsertFUCCI(CA)5
UseLentiviralTagsAzaleaB5-hCdt1(1/100)Cy(-)_P2A_h2-3-hGem(1/110)ExpressionMammalianAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV/D377Y-mPCSK9 (AAV8)
Viral Prep#58376-AAV8PurposeReady-to-use AAV8 particles produced from pAAV/D377Y-mPCSK9 (#58376). In addition to the viral particles, you will also receive purified pAAV/D377Y-mPCSK9 plasmid DNA. hAAT-driven expression of mutant (D377Y) murine PCSK9. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHCRApoE/hAATAvailable SinceJuly 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-FlipGFP(Casp3 cleavage seq) T2A mCherry
Plasmid#124428PurposeExpresses FlipGFP (caspase-3 cleavage sequence) and T2A mCherry in mammalian cellsDepositorInsertFlipGFP(Casp3 cleavage seq) T2A mCherry
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-FlipGFP(Casp3 cleavage seq) T2A mCherry
Plasmid#124428PurposeExpresses FlipGFP (caspase-3 cleavage sequence) and T2A mCherry in mammalian cellsDepositorInsertFlipGFP(Casp3 cleavage seq) T2A mCherry
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF3549
Plasmid#145025PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens. This is the control vector for the collection.DepositorInsertGFP
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry (AAV2)
Viral Prep#50459-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-DIO-mCherry (#50459). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-mCherry plasmid DNA. hSyn-driven, Cre-dependent mCherry-expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
dCas9-KRAB-MeCP2
Plasmid#110821PurposeImproved dCas9 repressor-dCas9-KRAB-MeCP2DepositorInsertdCas9-KRAB-MeCP2
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCMVAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCas9-KRAB-MeCP2
Plasmid#110821PurposeImproved dCas9 repressor-dCas9-KRAB-MeCP2DepositorInsertdCas9-KRAB-MeCP2
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCMVAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV PHP.eB)
Viral Prep#162375-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-q ONE-GO
Plasmid#189738PurposeGPCR/G protein BRET biosensorDepositorInsertsUseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ntn1-Fc-His
Plasmid#72104PurposeExpresses the entire Netrin 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntn1-Fc-His
Plasmid#72104PurposeExpresses the entire Netrin 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-EGFP (AAV1)
Viral Prep#50469-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CaMKIIa-EGFP (#50469). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-EGFP plasmid DNA. CamKIIa-driven EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsEGFPAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
SB100X in pCAG globin pA
Plasmid#127909PurposeSleeping Beauty Transposase expression vector driven by the CAG promoterDepositorInsertSleeping Beauty Transposase
ExpressionMammalianAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
SB100X in pCAG globin pA
Plasmid#127909PurposeSleeping Beauty Transposase expression vector driven by the CAG promoterDepositorInsertSleeping Beauty Transposase
ExpressionMammalianAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only