168,756 results
-
Plasmid#135074PurposeExpresses chicken cytoplasmic ovalbumin in lentiviral vector with puromycin resistance. cOVA is coupled with BFP fluorescent reporter using IRES.DepositorAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pEVOL-pAzF
Plasmid#31186PurposetRNA synthetase/tRNA pair for the in vivo incorporation of a photocrosslinker, p-azido-l-phenylalanine, into proteins in E coli response to the amber codon, TAGDepositorInsertM.j. p-azidohenylalanine RS (2 copies +tRNA)
ExpressionBacterialMutationY32T, E107N, D158P, I159L, L162Q, D286RAvailable SinceDec. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
CRY2olig-mCherry
Plasmid#60032PurposeExpresses a fusion of CRY2PHR E490G with mCherryDepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-HOXA9
Plasmid#237639PurposeFor overexpression of mEGFP-NUP98-HOXA9DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas9
Plasmid#167547PurposeUsed for CRISPR-Cas9 mediated recombineering in Enterococcus. Can clone desired gRNA using BsaI digestion.DepositorInsertschloramphenicol acetyl transferase
pUC19 origin of replication
UseCRISPRExpressionBacterialAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV-C-EGFP
Plasmid#122844PurposeC-terminal EGFP tag. Gateway destination vector for mammalian expression.DepositorTypeEmpty backboneUseGateway destinationTagsEGFPExpressionMammalianPromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
HDM-Hgpm2
Plasmid#204152PurposeLentivirus helper plasmid coding for Gag/PolDepositorInsertHIV-1 gag/pol
ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
HDM-tat1b
Plasmid#204154PurposeLentivirus helper plasmid coding for TatDepositorInserttat
ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2B-GFP
Plasmid#11680DepositorAvailable SinceMay 31, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRC-CMV-Rev1b
Plasmid#204153PurposeLentivirus helper plasmid coding for RevDepositorInsertRev
ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-NGR-WPRE (AAV1)
Viral Prep#234438-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-iGluSnFR4f-NGR-WPRE (#234438). In addition to the viral particles, you will also receive purified pAAV-syn-iGluSnFR4f-NGR-WPRE plasmid DNA. Syn-driven, iGluSnFR4f-NGR sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-MBP-super TEV protease
Plasmid#171782PurposeExpresses Maltose-binding protein-super TEV protease in bacterial cytoplasm. This protease version performs well in the absence of added reducing agent.DepositorInsertMBP-sTEV
TagsArg6 tag and Internal His6 tagExpressionBacterialMutationNo internal TEV cleavage site between the MBP and…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0
Plasmid#62987PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV-N-EGFP
Plasmid#122842PurposeN-terminal EGFP tag. Gateway destination vector for mammalian expression.DepositorTypeEmpty backboneUseGateway destinationTagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_ACh3.0
Plasmid#121922Purposeexpress the genetically-encoded fluorescent acethycholine(ACh) sensor GRAB-ACh3.0DepositorHas ServiceAAV9InsertGPCR activation based ACh sensor GRAB-ACh3.0
UseAAVPromoterhSynAvailable SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT4-CMV-GFP
Plasmid#117046PurposeOptimized Sleeping Beauty Transposon Vector for GFP expression by a CMV promoterDepositorInsertGFP
UseTransposonPromoterCMVAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1328 LV EF1a-CD20 IRES-EGFP
Plasmid#201918Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD20DepositorInsertCD20
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
HDM_RSV_B1_G_31AACTdel
Plasmid#237354PurposeExpression plasmid for RSV B1 GDepositorInsertRSV B1 G human codon optimized from Genbank Accesion AF013254
ExpressionMammalianMutation31 amino acid cytoplasmic tail deletionPromoterCMVAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP
Plasmid#37825PurposeAAV-mediated expression of GFP under the CAG promoterDepositorHas ServiceAAV CAP-B10, AAV CAP-B22, AAV MaCPNS1, AAV MaCPNS2, AAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV6, AAV6 trial size, AAV8, AAV8 trial size, AAV9, AAV9 trial size, and AAV9-X1.1InsertGFP
UseAAV; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only