-
Plasmid#162727PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330 NC-FKBP-Cas9
Plasmid#162725PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330 L-FKBP-Cas9
Plasmid#162728PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFrt-invCAG-Luc
Plasmid#63577PurposeShuttle vector compatible with Flp-mediated (Flp-in) transgene integration that allows for conditional Luciferase expression upon integration. The vector contains an FRT site and two mutant loxP sitesDepositorInsertStop-Lox71-Luciferase-pA-FRT-Lox66-reverseCAG
UseCre/Lox; Frt/flpe recombination mediated insertionTagsExpressionMammalianMutationPromoterAvailable sinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 LC-FKBP-Cas9
Plasmid#162724PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-WT
Plasmid#85847PurposeDonor plasmid for SNCA exon3 wild type sequence. lso contains TagBFP and dTomatoDepositorInsertSNCA exon 3 homology arms (SNCA Human)
UseTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 NLC-FKBP-Cas9
Plasmid#162726PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 C-FKBP-Cas9
Plasmid#162729PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe2-WT
Plasmid#85845PurposeDonor plasmid for SNCA exon2 wild type sequence. Also contains TagBFP and EGFPDepositorInsertSNCA exon 2 homology arms (SNCA Human)
UseTags-ExpressionBacterial and MammalianMutation-PromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
KG#84
Plasmid#110878PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA in ventral cord cholinergic motor neuronsDepositorInsertsunc-17beta promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationChanged Proline to Serine at amino acid 260PromoterAvailable sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#81
Plasmid#110876PurposeExpresses the C. elegans acy-1 P260S gain-of-function cDNA in body wall muscleDepositorInsertsmyo-3 promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationChanged Proline to Serine at amino acid 260PromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#205
Plasmid#110881PurposeExpresses the C. elegans pde-4 (isoform d) D448N cDNA pan-neuronallyDepositorInsertsrab-3 promoter
pde-4d (isoform d) D448N cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationchanged Asp 448 to AsnPromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#83
Plasmid#110877PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA pan-neuronallyDepositorInsertsrab-3 promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationChanged Proline to Serine at amino acid 260PromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-A53T
Plasmid#85848PurposeDonor plasmid for SNCA exon3 A53T sequence. Also contains EGFP and tagBFPDepositorInsertSNCA exon 3 homology arms (SNCA Human)
UseTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPLP1.3
Plasmid#22615DepositorInsertProteolipid Protein
UseE. coli phagemid vectorTagsExpressionMutationPromoterAvailable sinceNov. 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
pChimera
Plasmid#61476PurposeVector for conventional cloning that contains AtU6-26 promoter and sgRNA backboneDepositorInsertU6-26:sgRNA
UseCRISPRTagsExpressionPlantMutationPromoterU6-26Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Drp1(A395D)-StrepII
Plasmid#174430PurposeExpresses human Drp1 Isoform 3 with A395D mutation in bacteriaDepositorInsertDrp1
UseTagsStrepIIExpressionBacterialMutationA395DPromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Drp1-StrepII
Plasmid#174428PurposeExpresses human Drp1 Isoform 3 in bacteriaDepositorInsertDrp1
UseTagsStrepIIExpressionBacterialMutationNonePromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only