-
Plasmid#60879PurposeBacterially expressed GST-tagged human polo-like kinase 1 PBD AA 365-653 H538A/K540M mutantDepositorInsertPolo-like kinase 1 (PLK1 Human, BC01486)
UseTagsGSTExpressionBacterialMutationH538A/K540MPromoterAvailable sinceNov. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sema3b(L)-AP-His
Plasmid#72013PurposeExpresses the Sema3B protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3b (Sema3b Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ncam1_1.0.1-AP-His
Plasmid#71961PurposeExpresses the extracellular region of the NCAM1, isoform 1.0.1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNcam1_1.0.1 (Ncam1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
J23114-mRFP1-331Bb
Plasmid#78279PurposemRFP1 behind constitutive promoter J23114 in pSEVA331Bb backboneDepositorInsertJ23114-mRFP1
UseTagsExpressionMutationPromoterAvailable sinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sema6a.a-AP-His
Plasmid#72037PurposeExpresses the extracellular region of the Sema6A, isoform a protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema6a.a (Sema6a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6a.a-Fc-His
Plasmid#72163PurposeExpresses the extracellular region of the Sema6A, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema6a.a (Sema6a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-Fc-His
Plasmid#72147PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema3f (Sema3f Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-AP-His
Plasmid#72010PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV_Sox2 HMEJ donor
Plasmid#97322PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Sox2. AAV backbone.DepositorInsertSox2 HMEJ donor
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
mPapaya-Calnexin-N-14
Plasmid#56343PurposeLocalization: Endoplasmic Reticulum, Excitation: 530, Emission: 541DepositorInsertCalnexin (CANX Human)
UseTagsmPapayaExpressionMammalianMutationI474N in CalnexinPromoterCMVAvailable sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(L)-Fc-His
Plasmid#72165PurposeExpresses the extracellular region of the Sema6B protein (entire extracellular domain; ie, long), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema6b (Sema6b Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV_Nanog HMEJ donor
Plasmid#97321PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Nanog. AAV backbone.DepositorInsertNanog HMEJ donor
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sema4c-Fc-His
Plasmid#72156PurposeExpresses the extracellular region of the Sema4C protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4c (Sema4c Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCT-CMV-UBE3BΔHECT-copGFP-Puro
Plasmid#107343PurposeExpresses UBE3B deletion of HECT domain fused to copGFP in mammalian cells.DepositorInsertUBE3B(ΔHECT)-copGFP (UBE3B Human)
UseLentiviralTagscopGFPExpressionMammalianMutationdeletion of HECT domain (757-end)PromoterCMVAvailable sinceJune 26, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR221-JUN
Plasmid#79512PurposeMultiSite Gateway entry clones, second fragment (attL5, attL2) Human JUN CDSDepositorInsertJUN (JUN Human)
UseMultisite gateway entry cloneTagsHA TagExpressionMutationPromoterno PromoterAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL2 G116
Plasmid#123088PurposeGateway entry clone encoding human GABARAPL2 G116DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseGateway entry vector / entry cloneTagsExpressionMutationDeleted amino acid 117. Stop codon after G116PromoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Cdx2 HMEJ donor
Plasmid#97319PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Cdx2. AAV backbone.DepositorInsertCdx2 HMEJ donor
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000231737
Plasmid#78162PurposeLuciferase controlDepositorInsertLuciferase
UseRNAiTagsExpressionMutationPromoterhU6 and hU6Available sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only