We narrowed to 16,707 results for: grna
-
Plasmid#133458PurposeU6 promoter expresses customizable Spyo-guide; PGK promoter expresses blasticidin resistance and 2A site provides EGFPDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-mCh-Oct4i
Plasmid#21906DepositorInsertOct4i
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-shGL2
Plasmid#60004PurposeCo-expresses control GL2 shRNA and GFP.DepositorInsertEGFP
UseRNAiExpressionMammalianAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUB-Cas9-@GL1
Plasmid#86779PurposeDisruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9DepositorInsertsgRNA against GLABROUS1
UseSynthetic BiologyExpressionPlantPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSRP-mTAZ
Plasmid#31795DepositorInsertTAZ
UseRNAi and RetroviralPromoterRNA Pol-IIIAvailable SinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-PRAS40
Plasmid#15477DepositorAvailable SinceAug. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
Geph CR shRNA
Plasmid#121068PurposeshRNA targeting the coding region of the gephyrin mRNADepositorInsertGPHN shRNA (Gphn Rat)
UseRNAiAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Mff1 shRNA
Plasmid#37247DepositorAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-RNF40i1
Plasmid#59594PurposeExpression of shRNA against human RNF40DepositorAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO
Plasmid#172225PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the centromeric human SOX17 CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pV1435
Plasmid#111439PurposeSolo vector pV1382 + sgCgADE2DepositorInsertCaCas9/sgCgADE2
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
hADAM10 siRNA pSIREN-Retro-Q
Plasmid#19140DepositorInsertADAM10 siRNA
UseRNAi and RetroviralExpressionMammalianAvailable SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 GFP B56 alpha shRNA 6-3
Plasmid#10680DepositorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Tyr
Plasmid#170293PurposeA knock-out vector for the mouse tyrosinase.DepositorInsertA gRNA targeting the mouse tyrosinase gene.
UseCRISPR and LentiviralAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 EB1 shRNA #3
Plasmid#37927DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSicoR mouse Dicer3
Plasmid#14781DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDYSCKO-ADE1
Plasmid#120264PurposepDYSCKO canavanine co-selection vector with a guide targeting the ADE1 locusDepositorInsertpDYSCKO cassette-ADE1 targeting guide
UseCRISPR and Synthetic BiologyPromoterSNR52Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAT206/Sept7shRNA
Plasmid#38299DepositorAvailable SinceNov. 21, 2012AvailabilityAcademic Institutions and Nonprofits only