We narrowed to 16,083 results for: grna
-
Pooled Library#134583PurposeTargets Drosophila orthologs of vertebrate genes that have undergone expansion in the vertebrate lineDepositorExpressionInsectSpeciesDrosophila melanogasterUseCRISPRAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only
-
Drosophila_sgRNA_group_1
Pooled Library#134582PurposeTargets kinases, phosphatases, and Drosophila orthologs of drug targetsDepositorExpressionInsectSpeciesDrosophila melanogasterUseCRISPRAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
MKC62_HBB(HBA1reg-HBA1-2A-YFP)
Plasmid#232408PurposeAAV production plasmid for HBA1-2A-YFP vector from Fig. 2 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank full HBA1-2A-YFP cassette.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgCD20
Plasmid#209749PurposeLentiviral transfer plasmid to express Cas9 and a gRNA targeting the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD425
Plasmid#202078PurposeFrame +0 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +0 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD427
Plasmid#202080PurposeFrame +2/-1 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +2/-1 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgNRF2-4
Plasmid#186839Purposeknock out NRF2 in mammalian cellsDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_sgCtrl#1
Plasmid#174148PurposeLentiviral vector expressing Cas9 and a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Yap shRNA
Plasmid#166486PurposeMouse Yap RNAiDepositorInsertshRNA for mouse Yap (Yap1 Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR-Zeo
Plasmid#158709PurposeFor cloning and constitutive expression of crRNAs in mycobacteriumDepositorInsertcrRNA
UseCRISPR and Synthetic Biology; Mycobacteria expres…ExpressionBacterialPromoterHsp60Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
BRD4-N CRISPR
Plasmid#140651PurposeBRD4 tagging CRISPRDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shSV40 neo
Plasmid#158646PurposeLentiviral shRNA vector targeting simian virus 40 T antigen (SV40Tag)DepositorInsertSV40Tag (SV40gp6 Simian virus 40)
UseLentiviralAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-CDS
Plasmid#136037PurposeUPF1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (AAGACACCTATTACACGAAGG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE_KKH C-terminal
Plasmid#137184PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE, and U6-sgRNA (KKH variant).DepositorInsertv5 AAV-saCBE_KKH C-terminal
UseAAVMutationE782K;N968K;R1015H conferring recognition of NNNR…PromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ TREX1-KI
Plasmid#127701PurposeFor knocking in TREX1 in mouse - Doxycyclin inducibleDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro.puro-shNC
Plasmid#113535PurposeControl retroviral vector.DepositorInsertshNC (scrambled control shRNA)
UseRetroviralAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFH6_new
Plasmid#105866Purposemore efficient version of pFH6; Subcloning of any sgRNA via BbsI siteDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR and Synthetic Biology; SubcloningExpressionPlantAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAT206/Sept7shRNA
Plasmid#38299DepositorAvailable SinceNov. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-sh-mFAK C
Plasmid#37015DepositorAvailable SinceMay 31, 2012AvailabilityAcademic Institutions and Nonprofits only