-
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianMutationPromoterU6Available sinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.U6.DR130(CasRX)_Non-targeting sgRNA.EFS.tRFP657
Plasmid#212962PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.DepositorInsertDR1_CasRx_non-targeting spacer
UseCRISPR and LentiviralTagsTagRFP657ExpressionMammalianMutationPromoterU6Available sinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXR004: CasRx pre-gRNA cloning backbone
Plasmid#109054PurposehU6-driven expression of guide RNAs compatible with CasRx. Contains BbsI sites for guide cloning flanked by 5' and 3' full-length DRsDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDAS12230_pegRNA-PEAR-GFP(10PBS-24RT)-mCherry
Plasmid#177182Purposeplasmid expressing a pegRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertpegRNA targeting the PEAR-GFP plasmid
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA Ef1alpha Puro-T2A-GFP
Plasmid#111596PurposesgRNA Ef1alpha Puro-T2A-GFPDepositorInsertmU6-sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI
Plasmid#189924PurposeAAV genome encoding SaABE8eV106W and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVTagsExpressionMutationSaCas9 D10A, TadA ABE8e V106WPromoterEFSAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI large stuffer
Plasmid#52628Purposelentiviral U6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sites, improved cassette cloning efficiencyDepositorInsertKanamycin cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189922PurposeAAV genome encoding SaABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e
UseAAVTagsExpressionMutationSaCas9 D10APromoterEFSAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.U6.DR130(CasRX)_GFP-targeting sgRNA.EFS.tRFP657
Plasmid#212963PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.DepositorInsertDR1_CasRx_GFP targeting spacer
UseCRISPR and LentiviralTagsTagRFP657ExpressionMammalianMutationPromoterU6Available sinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601 miniCMV-SaCas9-SpA-sgRNA scaffold
Plasmid#107055PurposeBackbone vector for cloning in target sgRNA for use with SaCas9 (SauCas9)DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA(MS2)_MCP-VP64-IRES-zsGreen1
Plasmid#138461Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-VP64DepositorInsertMCP-VP64-IRES-zsGreen1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1AAvailable sinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-Nme/Nme2Cas9-sgRNA (KAC32)
Plasmid#133794PurposeU6 promoter sgRNA entry vector used for all NmeCas9 or Nme2Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Amrani et al. Genome Biology 2018DepositorInsertNmeCas9 and Nme2Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationsgRNA architecture from Amrani et al. Genome Biol…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112)
Plasmid#181791PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
UseTagsExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKL038 Lenti U6 dCas12a gRNA Puro mCherry
Plasmid#195546PurposedCas12a gRNA expression backboneDepositorInsertLenti U6- empty cassette_Direct repeat_puro_mcherry
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpCMVAvailable sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only