-
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBx-Spas-sgRNA-Gm
Plasmid#105232PurposePlasmid containing S. pasteurianus sgRNA with no 20bp target (Empty control) Gentamycin marker for P. aeruginosaDepositorInsertS. pasteurianus sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBluescriptSKII+ U6-sgRNA(F+E) ACTB
Plasmid#74705PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of ACTB mRNADepositorInsertU6 promoter driving sgRNA targeting the 3'UTR of ACTB mRNA
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA RBM20
Plasmid#162735PurposeMammalian expressionDepositorInsertSpacer sequence for RBM20
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
DR274-eGFP sgRNA
Plasmid#61051Purposefor generation of a eGFP specific sgRNA from a T7 promoterDepositorInsertEGFP sgRNA
UseCRISPRTagsExpressionMutationPromoterT7Available sinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #2
Plasmid#61514Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgccgctcccggatctcctgc
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-Lib
Plasmid#53121PurposesgRNA expression construction in a 3rd generation lentiviral backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU3d/LacZ
Plasmid#66201Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorTagsExpressionMutationPromoterAtU3dAvailable sinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEJS1096 Dual-sgRNA.Design 1
Plasmid#159538PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 nuclease with two guide RNA cassettes with promoters
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianMutationPromoterU1aAvailable sinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 EGFR-sgRNA
Plasmid#188633PurposeA human codon-optimized SpCas9 and chimeric guide RNA targeting C-terminus of human EGFRDepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBluescriptSKII+ U6-sgRNA(F+E) TFRC
Plasmid#74709PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of TFRC mRNADepositorInsertU6 promoter driving sgRNA targeting the 3'UTR of TFRC mRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA2
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralTagsExpressionMutationPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-2XboxB
Plasmid#75391PurposesgRNA1-2XboxBDepositorInsertsgRNA1-2XboxB
UseCRISPR and LentiviralTagsnoExpressionMammalianMutationPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #1
Plasmid#202516PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorInsertRB1 sgRNA (RB1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ANLN_sgRNA
Plasmid#183874PurposepX459V2.0-HypaCas9 plasmid with ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorInsertANLN sgRNA spacer (ANLN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Non-specific sgRNA
Plasmid#109432PurposeMLM3636 backbone containing a gRNA that does not bind to any sequence in the human genome.DepositorInsertNon-specific gRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only