Showing: 9981 - 10000 of 184702 results
-
Plasmid#82497PurposeLongitudinal monitoring of Gaussia and Nano luciferase activities to simultaneously assess ER calcium homeostasis and ER stress in vivoDepositorInsertsecNLuc
UseAAVTagsExpressionMammalianMutationPromoter5x(ATF6 binding site) c-Fos minimal promoterAvailabilityAcademic Institutions and Nonprofits only -
pOTTC841 - pAAV minP secNLuc
Plasmid#82498PurposeLongitudinal monitoring of Gaussia and Nano luciferase activities to simultaneously assess ER calcium homeostasis and ER stress in vivoDepositorInsertsecNLuc
UseAAVTagsExpressionMammalianMutationPromoterc-Fos minimal promoterAvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-1UAG
Plasmid#82500PurposeExpresses GFP with 1 UAG codon at the amino acid position 3DepositorInsertGreen Fluorescent Protein with 1 UAG codon
UseTagsExpressionBacterialMutationAdded an UAG codon at the amino acid position 3PromoterAraBADAvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-3UAG
Plasmid#82501PurposeExpresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153DepositorInsertGreen Fluorescence Protein with 3 UAG codons
UseTagsExpressionBacterialMutationAdded an UAG codon at the amino acid position 3, …PromoterAraBADAvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMeo
Plasmid#82502PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. G418 resistance is encoded by the Meo gene.DepositorInserteGFP-IRESMeo
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMygro
Plasmid#82503PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. Hygromycin B resistance is encoded by the Mygro gene.DepositorInserteGFP-IRESMygro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMuro
Plasmid#82504PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInserteGFP-IRESMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-mCherry-IRESMygro
Plasmid#82505PurposeVector targeting the mCherry gene to the GAPDH locus of human cells. mCherry is expressed from a 2A sequence at the C terminus of GAPDH. Hygromycin B resistance is encoded by the Mygro gene.DepositorInsertmCherry-IRESMygro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-GFP
Plasmid#82506PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH.DepositorInserteGFP
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-LacZ-IRESMuro
Plasmid#82507PurposeVector targeting the LacZ gene to the GAPDH locus of human cells. LacZ is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertLacZ-IRESMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Luc2-IRESMeo
Plasmid#82509PurposeVector targeting the Firefly Luciferase (Luc2) gene to the GAPDH locus of human cells. It is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Meo gene.DepositorInsertLuc2-IRESMeo
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-YFP-Eed
Plasmid#82512PurposeLentivirus vector. Expresses YFP-Eed fusion proteins in mammalian cells.DepositorInsertembryonic ectoderm development
UseLentiviralTagsHaloTagExpressionMammalianMutationinsert contains AA39-441 of EeDPromotercmvAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx4
Plasmid#82513PurposeLentivirus vector. Expresses Halotag-Cbx4 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 4 (Cbx4 Mouse)
UseLentiviralTagsHaloTagExpressionMammalianMutationPromotercmvAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx6
Plasmid#82514PurposeLentivirus vector. Expresses Halotag-Cbx6 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 6 (CBX6 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationPromotercmvAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx7
Plasmid#82515PurposeLentivirus vector. Expresses Halotag-Cbx7 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 7 (CBX7 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationPromotercmvAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ(M)-HT-Cbx8
Plasmid#82516PurposeLentivirus vector. Expresses halotag Cbx8fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 8 (CBX8 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationPromotercmvAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-H2A-HT
Plasmid#82517PurposeLentivirus vector. Expresses H2A-Halotag fusion proteins in mammalian cells.DepositorInsertHistone H2A
UseLentiviralTagsHaloTagExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-NLS
Plasmid#82518PurposeLentivirus vector. Expresses Halotag proteins with nuclear localization signal in mammalian cells.DepositorInsertNuclear localizaition sequence
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-CD(Cbx7)
Plasmid#82520PurposeLentivirus vector. Expresess mutant Halotag-CD-Cbx7 fusion proteins in mammalian cells. Express Chromodomain of Cbx7; amino acids 8–62.DepositorInsertChromobox Homolog 7 (CBX7 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationamino acids 8–62PromoterCMVAvailabilityAcademic Institutions and Nonprofits only
Showing: 9981 - 10000 of 184702 results