-
Plasmid#81179PurposeRetroviral vector for expression of kinase inactive PAK2 with a CFP fusionDepositorInsertp21 (RAC1) activated kinase 2 (PAK2 Human)
UseRetroviralTagsCFPExpressionMutationT402APromoterP-tight TREAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema3d(L)-AP-His
Plasmid#72017PurposeExpresses the Sema3D protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3d (Sema3d Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntn4-Fc-His
Plasmid#72106PurposeExpresses the entire Netrin 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtn4 (Ntn4 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-AP-His
Plasmid#72021PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3f (Sema3f Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP3-bio
Plasmid#47731PurposeExpresses enzymatically monobiotinylated full-length MSP3 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP3
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.27kb-EGFP
Plasmid#153185PurposeTruncated mouse gamma-synuclein (mSncg-0.27kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC840 - pAAV 5xATF6 secNLuc
Plasmid#82497PurposeLongitudinal monitoring of Gaussia and Nano luciferase activities to simultaneously assess ER calcium homeostasis and ER stress in vivoDepositorInsertsecNLuc
UseAAVTagsExpressionMammalianMutationPromoter5x(ATF6 binding site) c-Fos minimal promoterAvailable sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSP2-bio
Plasmid#47710PurposeExpresses enzymatically monobiotinylated full-length MSP2 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP2
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F5
Plasmid#55788PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (3550-4450aa)DepositorInsert3xFLAG tagged HERC2 (3550-4450aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailable sinceJuly 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-SV40-RFP
Plasmid#65448PurposeExpression of RFP in mammalian cells. Control vector for FUW-Ephrin-RFP vectorsDepositorInsertSV40-RFP
UseLentiviralTagsExpressionMammalianMutationPromoterUBQAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F2
Plasmid#55785PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (950-1750aa)DepositorInsert3xFLAG tagged HERC2 (950aa-1750aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailable sinceJuly 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
AID-BFP-loxP_myo2_neoR
Plasmid#194054PurposeDual-selection cassette plasmid for knocking-in AID-BFP into the C. elegans genomeDepositorInsertIAA17 (AXR3 Mustard Weed)
UseTagsbfpExpressionWormMutationPromoterNoneAvailable sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX nsp1 R99A CoV2
Plasmid#175515PurposeFor protein expression of R99A nsp1 CoV2DepositorInsertR99A nsp1 CoV2
UseTagsGST tagExpressionBacterialMutationPromotertac promoterAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET15b LFn-Fla 3A
Plasmid#84872PurposeBacterial expression of LFn-Fla 3A fusion. This is a negative control for LFn FlaA in which the 3 C-terminal leucines have been replaced by alanine.DepositorInsertsLFn
Fla
UseTagsHisExpressionBacterialMutation3 C-terminal leucines have been replaced by alani…PromoterT7Available sinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3HA-ErbB4CTF
Plasmid#17803DepositorInsertErbB4 (ERBB4 Human)
UseTagsHAExpressionMammalianMutationCarboxy-terminal fragment, amino acids 676-1292PromoterAvailable sinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
L-YARS2-9
Plasmid#166533PurposescFv of a human scaffold targeting Tyrosyl-tRNA synthetase 2, mitochondrial. Antigen coverage aa 31-477 of 477DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable sinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX-B3omega1 (GB1694)
Plasmid#160643PurposepLX series: pBBR1-based T-DNA binary vector for plant transformation (omega1)DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Strep/HA-UBE2QL1
Plasmid#124665PurposeExpresses UBE2QL1 with N-terminal Strep-HA tag in mammalian cellsDepositorInsertUBE2QL1 (UBE2QL1 Human)
UseTags2xStrep/HAExpressionMammalianMutationPromoterCMVAvailable sinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + FlaAAA
Plasmid#84867PurposeBaculovirus Expression of LFn-FlaAAA fusion. This is a negative control for LFn FlaA in which the 3 C-terminal leucines have been replaced by alanine.DepositorInsertsLFn
FlaAAA
UseBaculovirusTags6xHisExpressionInsectMutation3 C-terminal leucines have been replaced by alani…PromoterPolyhedrinAvailable sinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only