Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FUW-ubiquitin-SV40-RFP
(Plasmid #65448)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65448 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUW
  • Backbone manufacturer
    Addgene Plasmid 14882
  • Total vector size (bp) 10327
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SV40-RFP
  • Alt name
    mRFP
  • Insert Size (bp)
    727
  • Promoter UBQ

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer hUBCpro-F
  • 3′ sequencing primer mRFP1-R GGAGCCGTACTGGAACTGAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-ubiquitin-SV40-RFP was a gift from Eduard Batlle (Addgene plasmid # 65448 ; http://n2t.net/addgene:65448 ; RRID:Addgene_65448)
  • For your References section:

    EphB-ephrin-B interactions suppress colorectal cancer progression by compartmentalizing tumor cells. Cortina C, Palomo-Ponce S, Iglesias M, Fernandez-Masip JL, Vivancos A, Whissell G, Huma M, Peiro N, Gallego L, Jonkheer S, Davy A, Lloreta J, Sancho E, Batlle E. Nat Genet. 2007 Nov;39(11):1376-83. Epub 2007 Sep 30. 10.1038/ng.2007.11 PubMed 17906625