-
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.FLAG_NGFR
Plasmid#158249PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.VSVg_NGFR
Plasmid#158232PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone3
Plasmid#162130PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.S.VSVg_mCherry-NLS
Plasmid#178269PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.S.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.VSVg_mCherry-NLS
Plasmid#178261PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.S_mCherry-NLS
Plasmid#178260PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.S.VSVg_mCherry-NLS
Plasmid#178255PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.S.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.VSVg_mCherry-NLS
Plasmid#178246PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.S_mCherry-NLS
Plasmid#178245PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.VSVg_mCherry-NLS
Plasmid#178241PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.S_mCherry-NLS
Plasmid#178240PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.HSV_mCherry-NLS
Plasmid#178237PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.HSV and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.VSVg_mCherry-NLS
Plasmid#178225PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.C.V5_NGFR
Plasmid#158331PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.C.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.Ollas_mCherry-NLS
Plasmid#178223PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.V5_mCherry-NLS
Plasmid#178221PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.Ollas_mCherry-NLS
Plasmid#178218PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.V5_mCherry-NLS
Plasmid#178215PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only