-
Plasmid#65448PurposeExpression of RFP in mammalian cells. Control vector for FUW-Ephrin-RFP vectorsDepositorInsertSV40-RFP
UseLentiviralTagsExpressionMammalianMutationPromoterUBQAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F2
Plasmid#55785PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (950-1750aa)DepositorInsert3xFLAG tagged HERC2 (950aa-1750aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailable sinceJuly 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
AID-BFP-loxP_myo2_neoR
Plasmid#194054PurposeDual-selection cassette plasmid for knocking-in AID-BFP into the C. elegans genomeDepositorInsertIAA17 (AXR3 Mustard Weed)
UseTagsbfpExpressionWormMutationPromoterNoneAvailable sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX nsp1 R99A CoV2
Plasmid#175515PurposeFor protein expression of R99A nsp1 CoV2DepositorInsertR99A nsp1 CoV2
UseTagsGST tagExpressionBacterialMutationPromotertac promoterAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET15b LFn-Fla 3A
Plasmid#84872PurposeBacterial expression of LFn-Fla 3A fusion. This is a negative control for LFn FlaA in which the 3 C-terminal leucines have been replaced by alanine.DepositorInsertsLFn
Fla
UseTagsHisExpressionBacterialMutation3 C-terminal leucines have been replaced by alani…PromoterT7Available sinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3HA-ErbB4CTF
Plasmid#17803DepositorInsertErbB4 (ERBB4 Human)
UseTagsHAExpressionMammalianMutationCarboxy-terminal fragment, amino acids 676-1292PromoterAvailable sinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
L-YARS2-9
Plasmid#166533PurposescFv of a human scaffold targeting Tyrosyl-tRNA synthetase 2, mitochondrial. Antigen coverage aa 31-477 of 477DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable sinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX-B3omega1 (GB1694)
Plasmid#160643PurposepLX series: pBBR1-based T-DNA binary vector for plant transformation (omega1)DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Strep/HA-UBE2QL1
Plasmid#124665PurposeExpresses UBE2QL1 with N-terminal Strep-HA tag in mammalian cellsDepositorInsertUBE2QL1 (UBE2QL1 Human)
UseTags2xStrep/HAExpressionMammalianMutationPromoterCMVAvailable sinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + FlaAAA
Plasmid#84867PurposeBaculovirus Expression of LFn-FlaAAA fusion. This is a negative control for LFn FlaA in which the 3 C-terminal leucines have been replaced by alanine.DepositorInsertsLFn
FlaAAA
UseBaculovirusTags6xHisExpressionInsectMutation3 C-terminal leucines have been replaced by alani…PromoterPolyhedrinAvailable sinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(S, +)-AP-His
Plasmid#72023PurposeExpresses the Sema3F protein (truncated at cleavage site P1; ie, short and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3f (Sema3f Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4f.b-Fc-His
Plasmid#72159PurposeExpresses the extracellular region of the Sema4F, isoform b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4f.b (Sema4f Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
HcRed-pcw107-V5
Plasmid#64647Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5ExpressionMutationPromoterPGKAvailable sinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
O-MARS-11
Plasmid#166541PurposescFv of a human scaffold targeting Methionyl-tRNA synthetase. Antigen coverage aa 1-225 of 900DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialMutationPromoterLacZAvailable sinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFPm-DAD M1041A
Plasmid#25411DepositorInsertDiap3 (Diaph3 Mouse)
UseTagsEGFP, His, and MycExpressionMammalianMutationAlanine substitution at critical residue in DAD t…PromoterAvailable sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hAR-L26A,F27A
Plasmid#89084Purposemammalian expression of human androgen receptor with mutation of N-terminal FxxLF motifDepositorInserthAR FxxLF mutant (AR Human)
UseTagsExpressionMammalianMutationhAR-L26A,F27APromoterCMVAvailable sinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOCC120
Plasmid#118892Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal MBP tag, cleavable with 3C, and C-terminal monomeric GFP and HIS6, cleavable with TEVDepositorInsertNcoI-MBP-3C-NotI-ccdB-AscI-mGFP-3C-HIS6-stop-HindIII cassette
UseTagsMBP, cleavable with 3C protease and mGFP, HIS6, c…ExpressionInsectMutationPromoterpolHAvailable sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pk_CyRPA-Cd4-bio-His
Plasmid#126841PurposeExpression of recombinant P. knowlesi protein in mammalian cellsDepositorInsertCyRPA (PKH_052740 Plasmodium knowlesi)
UseTagsratCd4(d3+4)-bio-6HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-Fc-His
Plasmid#72130PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertPlxnb3 (Plxnb3 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only