-
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
UseTagsExpressionBacterialMutationPromoterCmYLCV PromoterAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6d-T
Plasmid#117212PurposeExpresses gRNA in Aedes aegyptiDepositorInsertu6d promoter-gRNA
UseSynthetic BiologyTagsExpressionInsectMutationPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-sgTAF12(human)#4.5
Plasmid#105987Purposelentivirally express gRNA targeting human TAF12 HFD with GFP markerDepositorInsertgRNA targeting human TAF12-HFD
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_2
Plasmid#86324PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_1
Plasmid#86321PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HMG20A_2
Plasmid#86319PurposeEncodes gRNA for 3' target of human HMG20ADepositorInsertgRNA against HMG20A (HMG20A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_1
Plasmid#86314PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_1
Plasmid#86323PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_2
Plasmid#86322PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HMG20A_1
Plasmid#86318PurposeEncodes gRNA for 3' target of human HMG20ADepositorInsertgRNA against HMG20A (HMG20A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KAT7_1
Plasmid#86309PurposeEncodes gRNA for 3' target of human KAT7DepositorInsertgRNA against KAT7 (KAT7 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide_DKO
Plasmid#183193PurposePlasmid with two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6, mU6Available sinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6, mU6Available sinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2200
Plasmid#91082PurposeModule C, Promoter: none – to be combined with gRNA array in module B, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers (only works with pMOD_B2203), Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRTagsExpressionMutationPromoternone (will be fused to gRNA array in MODULE B)Available sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_2
Plasmid#101075PurposeEncodes gRNA for 3' target of human KMT2BDepositorInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_1
Plasmid#101074PurposeEncodes gRNA for 3' target of human KMT2BDepositorInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-neo-sgTAF12(human)#4.4
Plasmid#105590Purposelentivirally express gRNA targeting human TAF12 HFD with GFP marker and neo resistanceDepositorInsertgRNA targeting human TAF12 HFD
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only