We narrowed to 42,030 results for: kan
-
Plasmid#202146PurposeLevel 0 plasmid containing a mTurquoise2 fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertmTurquoise2 gene
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_CD-mRFP1
Plasmid#202145PurposeLevel 0 plasmid containing a mRFP1 fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertmRFP1 gene
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eYGFP-uv
Plasmid#202144PurposeLevel 0 plasmid containing an eYGFP-uv fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteYGFP-uv gene
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-mcherry
Plasmid#202143PurposeLevel 0 plasmid containing a mCherry fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertmCherry gene
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eCFP
Plasmid#202142PurposeLevel 0 plasmid containing an eCFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteCFP gene
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-roGFP
Plasmid#202140PurposeLevel 0 plasmid containing a roGFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInsertroGFP gene
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-eYFP
Plasmid#202139PurposeLevel 0 plasmid containing an eYFP fluorescent protein with CD overhangs used to build a level 1 construct.DepositorInserteYFP gene
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_CD-GUS
Plasmid#202137PurposeLevel 0 plasmid containing a beta glucuronidase reporter gene with CD overhangs used to build a level 1 construct.DepositorInsertBeta glucuronidase gene
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AF-spacer
Plasmid#202130PurposeLevel 0 plasmid containing a small non-coding spacer sequence with AF overhangs used to build level 1 constructs.DepositorInsertSpacer
UseSynthetic BiologyMutationNoneAvailable sinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Guzit
Bacterial strain#196902PurposeGuzit is a RNase HI(rnhA) His-tagged E. coli strain made for a cell-free expression system.DepositorBacterial resistanceKanamycinAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNase III-His
Bacterial strain#196903PurposeRNase III-His is an E. coli strain made for a cell-free expression system.DepositorBacterial resistanceKanamycinAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-GFP
Plasmid#238041PurposeEncodes sfGFP under lac promoter. Expresses a single guide RNA (under Rha promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable sinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-RFP
Plasmid#238040PurposeEncodes mRFP1 under pLux promoter. Expresses a single guide RNA (under Ara promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertmRFP1
UseSynthetic BiologyPromoterLuxAvailable sinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only