-
Plasmid#120081PurposeBroad host range plasmid. Bacteria plasmid vector to test various parts and devices. Expression of GFP and a nourseothricin resistance gene in various cyanobacteria.DepositorInsertPlasmid assembled from 3 CYANO-VECTOR modular devices: CV-RSF1010Y25F, CV-nat1_A7120, CV-PconII-LTRBS-GFPmut2
UseOtherTagsExpressionMutationmobA Y25FPromoterAvailable sinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM4889 (pCV0001)
Plasmid#120079PurposeBroad host range plasmid. Bacteria plasmid vector to test various parts and devices. Expression of GFP and a spectinomycin/streptomycin resistance gene in various cyanobacteria.DepositorInsertPlasmid assembled from 3 CYANO-VECTOR modular devices: CV-RSF1010Y25F, CV-aadA, CV-PconII-LTRBS-GFPmut2
UseOtherTagsExpressionMutationmobA Y25FPromoterAvailable sinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGTRm
Plasmid#127197PurposepGTRm is the template plasmid for PCR & golden gate assembly driven generation of polycistronic tRNA-gRNA sequencesDepositorInserttRNA-gRNA PCR template
UseTemplate plasmid for generation of golden gate pc…TagsExpressionMutationPromoterNoneAvailable sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMBA333
Plasmid#214745PurposeMedium copy thyA-infA plasmid containing gfp and no antibiotic resistance gene (ARG)DepositorInsertBBa_J23119-RiboJ-RBS(21992)-gfpmut3
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBA334
Plasmid#214746PurposeHigh copy thyA-infA plasmid containing gfp and no antibiotic resistance gene (ARG)DepositorInsertBBa_J23119-RiboJ-RBS(21992)-gfpmut3
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1
Plasmid#184397PurposeDonor plasmid for stable integration of firefly luciferase NMD(+) PTC39 reporter at AAVS1DepositorInsertFirefly luciferase beta-globin-PTC39
UseCRISPR; Donor plasmid for hdrTags3X FLAGExpressionMammalianMutationPTC in beta-globin at amino acid position 39PromoterTet-On 3GAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TetOn-3XFLAG-renilla-beta-globin-PTC39-AAVS1
Plasmid#184398PurposeDonor plasmid for stable integration of Renilla luciferase NMD(+) PTC39 reporter at AAVS1DepositorInsertRenilla luciferase beta-globin-PTC39
UseCRISPR; Donor plasmid for hdrTags3X FLAGExpressionMammalianMutationPTC in beta-globin at amino acid position 39PromoterTet-On 3GAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorInsertRAF1 (RAF1 Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
MIP 247 CoMiP 4in1 with shRNA p53
Plasmid#63726PurposeTo express Oct4, Klf4, Sox2, c-Myc and hairpin RNA p53. A single plasmid reprogramming system using a mini-intronic plasmid (MIP).UseTagsIRES-dtomatoExpressionMammalianMutationcodon-optimisedPromoterSFFV for Pct4, Klf4, Sox2 and c-myc; U6 for p53Available sinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Fon/ConN2cG
Plasmid#234709PurposepAAV transfer plasmid with Ef1a promoter driving Cre- and Flp-dependent expression of G protein for rabies N2c delta GDepositorInsertFon Con N2cG
UseAAVTagsExpressionMammalianMutationPromoterEf1aAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BMP2K
Plasmid#73251PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertBMP2KA (BMP2K Human)
UseTagsHis6-Zb-TEVExpressionBacterialMutationpfam00069:Pkinase 52-311PromoterT7Available sinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDZ2FE_Champ1_1-812
Plasmid#105675PurposeExpresses Flag-tagged full-length human Champ1 proteinDepositorInsertChamp1 (CHAMP1 Human)
UseTags2X Flag tagExpressionMammalianMutationPromoterAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGLIS3-donor
Plasmid#113812PurposeCRISPR donor plasmid to tag human transcription factor GLIS3 with GFPDepositorInsertGLIS3 homology arms flanking EGFP-IRES-Neo cassette (GLIS3 Human)
UseCRISPRTagsExpressionMutationrs10118031, rs10973702, rs912257PromoterAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-SARS-CoV-2 SL1 alone-Luciferase
Plasmid#191482PurposeLuciferase reporter for SARS-CoV-2 5' UTR SL1 aloneDepositorInsertSARS-CoV-2 5' UTR SL1 alone
UseLentiviral and LuciferaseTagsExpressionMutationContains only the stem-loop1 region of SARS-CoV-2…PromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-SARS-CoV-2 5’UTR ΔSL1-Luciferase
Plasmid#191481PurposeLuciferase reporter for SARS-CoV-2 5' UTR ΔSL1DepositorInsertSARS-CoV-2 5' UTR ΔSL1
UseLentiviral and LuciferaseTagsExpressionMutationMissing the stem-loop 1 region of SARS-CoV-2 5…PromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pANG03
Plasmid#178085PurposeTetracycline resistant backbone for in vivo Gateway reaction. Plasmid contains gateway cassette with restriction sites to add promoters or C and N Terminal tags. Compatible with pANG02.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterNAAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pANG01
Plasmid#178083PurposeCarbenicillin resistant backbone for in vivo Gateway reaction. Plasmid contains gateway cassette with restriction sites to add promoters or C and N Terminal tags. Compatible with pANG02.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterNAAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
T4 Lysozyme I3A
Plasmid#18200DepositorInsertT4 Lysozyme (e Bacteriophage T4)
UseTagsExpressionBacterialMutationI3APromoterAvailable sinceAug. 26, 2008AvailabilityAcademic Institutions and Nonprofits only