We narrowed to 20,945 results for: grna
-
Plasmid#167161PurposeExpress single gRNA with gRNA2.1 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only
-
1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109314PurposePlasmid for liver-specific expression of AAV SaCas9 with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g1 gRNA
Plasmid#86005Purposeplasmid vector encoding for U6-driven AAT_g1 gRNADepositorInsertpU6-AAT_g1 sgRNA
UseCRISPRExpressionMammalianPromoterpU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g2 gRNA
Plasmid#86006Purposeplasmid vector encoding for U6-driven AAT_g2 gRNA (Z-allele specific)DepositorInsertpU6-AAT_g2 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-W
Plasmid#208569PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(13))-PGKpuroBFP-W
Plasmid#208570PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(21))-PGKpuroBFP-W
Plasmid#200507PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(23))-PGKpuroBFP-W
Plasmid#200508PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(47))-PGKpuroBFP-W
Plasmid#200505PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10TC)_Psyn-sgRNA500
Plasmid#149583Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Neg. Ctrl_sgRNA
Plasmid#111298PurposeCRISPR KO murine neg. ctrl.DepositorInsertNegCtrl sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaBS-sgRNA500
Plasmid#149615PurposegRNA expression in B. burgdorferi, parental vectorDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaBSAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA1
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G8.1 gRNA
Plasmid#90837Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G8.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G7.1 gRNA
Plasmid#90836Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G7.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only