We narrowed to 7,721 results for: ski
-
Plasmid#91584PurposeExpress sgRNA targeting human CNOT1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pPN170
Plasmid#91599PurposeExpress sgRNA targeting human DLGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN171
Plasmid#91600PurposeExpress sgRNA targeting human DLGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN190
Plasmid#91577PurposeExpress sgRNA targeting human BRINP2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWZLblasti-HA-MEK5 CBM-E
Plasmid#53169PurposeExpresses HA tagged human MEK5 L280AH281AM323AQ332A from blasticidin resistance retroviral vectorDepositorInsertMEK5 (MAP2K5 Human)
UseRetroviralTagsHAExpressionMammalianMutationL280A/H281A/M323A/Q332AAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA5 FRT/TO SF-HERC2 (ShB-R)
Plasmid#55613PurposeDox-inducible expression of full length, ShB-resistant, 3xFLAG/STREP tagged wild-type HERC2 in Flp-In TREx cellsDepositorInsert3xFLAG tagged HERC2 (WT) (HERC2 Human)
Tags3xFLAG and STREPExpressionMammalianMutationSilent mutations have been incorporated into the …Available SinceJuly 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NLS
Plasmid#136468PurposeMammalian expression of nucleus targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsTriple nuclear localization signal of SV40 (simia…ExpressionMammalianPromoterCMV, SP6Available SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6_empty-sgRNA(PP7)
Plasmid#232432Purposeempty gRNA backbone which contains the PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged sgRNA scaffold driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY1622 NOLC1 sgRNA 1
Plasmid#234833PurposesgRNA 1 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY1623 NOLC1 sgRNA 2
Plasmid#234834PurposesgRNA 2 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP2-C-Flag
Plasmid#134287PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP2DepositorInsertSREBP2 (Srebf2 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP2 precursorPromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28.His.3C.Tau2N4R
Plasmid#226396PurposeExpresses his-tagged, 3C-cleavable WT 2N4R tau for recombinant protein production in bacteriaDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GenEPi
Plasmid#140236PurposeMammalian expression of Piezo1-based fluorescent force sensor GenEPiDepositorInsertGenEPi (Piezo1-based fluorescent force sensor) (PIEZO1 Human)
TagsGCaMP 6s RS1 EF4ExpressionMammalianPromotersimian CMV IE94Available SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PDi-CRISPRn
Plasmid#73500PurposeDox-inducible CRISPR nuclease (CRISPRn) knock in construct into the AAVS1 locusDepositorInsertsCas9
rtTA
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCAG and TREAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NC-CRISPRi (Gen3)
Plasmid#73499PurposeConstitutive CRISPR interference (CRISPRi) knock in construct into the AAVS1 locusDepositorInsertdCas9-KRAB
UseCRISPRTagsHA, KRAB, and NLSExpressionMammalianMutationD10A, H840A (catalytically deactivated Cas9)PromoterCAGAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pL40C_PGKintron_Cas9_Green
Plasmid#134966PurposeLentiviral vector coding Cas9 and mNeonGreenDepositorInsertCas9-P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterhPGK promoter with beta-globin intronAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF.STAT3C.Ubc.GFP
Plasmid#24983Purpose3rd generation lentiviral expression of constitutively active Stat3DepositorInsertSTAT3 (STAT3 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationA662C, N664C (constitutively active)Available SinceMay 28, 2010AvailabilityAcademic Institutions and Nonprofits only