-
Plasmid#85143Purposelentiviral expression of human VE-cadherin, C-terminally tagged with mCitrineDepositorInsertCDH5-mCitrine (VE-cadherin, C-terminally tagged with mCitrine (CDH5 Human)
UseLentiviralTagsmCitrineExpressionMutationPromoterCAGAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET32a-HD25Q
Plasmid#11508DepositorInserthuntingtin, exon 1, 25 glutamines (HTT Human)
UseTagsHis, His (out of frame), and TrxExpressionBacterialMutationhuntingtin exon 1 with 25 glutamines, vector m…PromoterAvailable sinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET32a-HD16Q
Plasmid#11487DepositorInserthuntingtin, exon 1, 16 glutamines (HTT Human)
UseTagsHis, His (out of frame), and TrxExpressionBacterialMutationhuntingtin exon 1 with 16 glutamines, vector m…PromoterAvailable sinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET32a-HD39Q
Plasmid#11514DepositorInserthuntingtin, exon 1, 39 glutamines (HTT Human)
UseTagsHis, His (out of frame), and TrxExpressionBacterialMutationhuntingtin exon 1 with 39 glutamines, vector m…PromoterAvailable sinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
Ai39
Plasmid#34884DepositorInsertCAG-Floxed eNpHRv3.0-EYFP
UseMouse TargetingTagsEYFPExpressionMutationPromoterCAGAvailable sinceFeb. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
Ai35
Plasmid#34882DepositorInsertCAG-Floxed Archaerhodopsin3-GFP
UseMouse TargetingTagsGFPExpressionMutationPromoterCAGAvailable sinceFeb. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
USPQ-HTT-TALEN1
Plasmid#92243PurposeTALEN targeting upstream of HTT gene (KKR), forms obligate heterodimer with USPQ-HTT-TALEN2DepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCMVAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
USPQ-HTT-TALEN2
Plasmid#92244PurposeTALEN targeting upstream of HTT gene (ELD), forms obligate heterodimer with USPQ-HTT-TALEN1DepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCMVAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-HDAC5-trun1)
Plasmid#114400PurposeFor PYL-HDAC5 aa 1-275 expressionDepositorInsertPYL-HDAC5 aa 1-275 (HDAC5 Human)
UseTags3xFlag-NLS (internal)ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAIP-hXRCC1pd-eGFP
Plasmid#206033PurposeMammalian expression of PAR-deficient hXRCC1pd coupled to eGFP under the control of a CAG promoterDepositorInserthXRCC1
UseTagseGFPExpressionMammalianMutationS103A,R186A,S184A,S193A,S219A,S220A,S236A,S268APromoterCAGAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
p55-H2B-Dendra2
Plasmid#80609PurposeEncodes H2B-Dendra2-fusion protein under the CAG promoter. Linearize using Asc1 and Not1 for mouse embryo injection.DepositorInsertH2B-Dendra2 (H2BC21 Human, Synthetic)
UseTagsDendra2ExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNHEJ-RPG
Plasmid#85931PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-NHEJ. Puro-T2A-EGFP
UseDual-reporter surrogateTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPPH-T2A-GFP-shP53
Plasmid#102897PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPPH-T2A-GFP-shP53
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_DRS-1 sgRNA / hSpCas9
Plasmid#172841PurposeMammalian expression of the DRS-1 synthetic sgRNA sequence under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertDRS-1 sgRNA under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSSA-RPG
Plasmid#85932PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-SSA. Puro-T2A-EGFP
UseDual-reporter surrogateTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_TUBA1B sgRNA / hSpCas9
Plasmid#172834PurposeMammalian expression of a sgRNA targeting the intron 1 of TUBA1B (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of TUBA1B under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPP300-T2A-GFP-shP53
Plasmid#102896PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPP300-T2A-GFP-shP53
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only