-
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-nurim
Plasmid#175110PurposeLentiviral expression of V5-tagged mouse NrmDepositorInsertNrm (Nrm Mouse)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc MOB1 T74A
Plasmid#47939Purposeexpresses Myc tagged human MOB1 containing T74A mutationDepositorInsertMOB1A (MOB1A Human)
UseTagsMycExpressionMammalianMutationT74APromoterCMVAvailable sinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_Lb
Plasmid#155051PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryExpressionMutationAnillin A740D, E758KPromoterU6, CMVAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc MOB1 T12A
Plasmid#47936Purposeexpresses Myc tagged human MOB1 containing T12A mutationDepositorInsertMOB1A (MOB1A Human)
UseTagsMycExpressionMammalianMutationT12APromoterCMVAvailable sinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-AR-S81E
Plasmid#171224PurposeMammalian expression of un-tagged human androgen receptor phosphorylation mutant: AR-Ser81Glu (AR-S81E)DepositorInserthuman androgen receptor Ser81Glu mutant (AR Human)
UseTagsExpressionBacterial and MammalianMutationAR-Ser81Glu (AR-S81E)PromoterCMVAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_LbCas12a.DR
Plasmid#155049PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and LbCas12a Direct Repeat (DR)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pDestTol2-pax3a-kcnj13-IRES-EGFP
Plasmid#164950PurposeTol2 construct: pax3a-5.4k promoter driven zebrafish kcnj13 fused with EGFP and EGFPDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPExpressionMutationPromoterpax3a promoter -5.4kAvailable sinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-actinb-kcnj13-IRES-EGFP
Plasmid#164941PurposeTol2 construct: actinb (actb2) promoter driven zebrafish kcnj13 and EGFPDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPExpressionMutationPromoteractinb (actb2) promoterAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_AsCas12a.DR
Plasmid#155050PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - AsCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and AsCas12a Direct Repeat (DR)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha270-1374S300/302A
Plasmid#62533PurposeN-terminal aa1-269 of Drosha is deleted and serines 300 &302 are mutated to alanineDepositorInserttruncated human Drosha mutant (DROSHA Human)
UseTagsGFPExpressionMammalianMutationdeleted amino acids 1-269 and changed serines 300…PromoterAvailable sinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha270-1374delNLS2
Plasmid#62532PurposeN-terminal aa1-269 and nuclear localization signal 2 of Drosha are deletedDepositorInserttruncated human Drosha mutant (DROSHA Human)
UseTagsGFPExpressionMammalianMutationdeleted amino acids 1-269 and nuclear localizatio…PromoterAvailable sinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc MOB1 T35A
Plasmid#47937Purposeexpresses Myc tagged human MOB1 containing T35A mutationDepositorInsertMOB1A (MOB1A Human)
UseTagsMycExpressionMammalianMutationT35APromoterCMVAvailable sinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only