Hybrid McpC[1-350]-YSYEH-Tar[272-553]

Hybrid Tar[1-43]-McpC[49-270]-Tar[184-553] expression plasmid

mammalian expression of Rab12

mammalian expression of Rab12 Q101L, constitutively GTP-bound mutant

mammalian expression of Rab12 T56N, constitutively GDP-bound mutant

REG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)

REG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG)

Expression of a sensor for synthetic sequence 1 (EK0208) with three MS2 sequences in the 3' UTR in mammalian cells. Compared to EK0285, also has additional restriction sites around the sensor sequence. Recommended for the basis for cloning new sensors for use with MCP-ADAR(DD). HindIII & MluI can be used to swap out marker (mCherry). (KpnI or BamHI) and (BshTI or BcuI) can be used to swap out sensor sequence (s70587). XhoI and ApaI can be used to swap out output (EGFP).

3rd generation lentiviral gRNA plasmid targeting human CCL2

3rd generation lentiviral gRNA plasmid targeting human CCL2