-
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5K85R
Plasmid#98694PurposeGateway cloning of human PRDX5-K85RDepositorInsertPRDX5 (PRDX5 Human)
UseGateway entry vectorTagsExpressionMutationK85RPromoterAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5K83R
Plasmid#98693PurposeGateway cloning of human PRDX5-K83RDepositorInsertPRDX5 (PRDX5 Human)
UseGateway entry vectorTagsExpressionMutationK83RPromoterAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5E80K
Plasmid#98692PurposeGateway cloning of human PRDX5-E80KDepositorInsertPRDX5 (PRDX5 Human)
UseGateway entry vectorTagsExpressionMutationE80KPromoterAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K85R-VA
Plasmid#98691PurposeLentiviral expression of human PRDX5-K85R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK85RPromoterCMVAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5E80K-VA
Plasmid#98689PurposeLentiviral expression of human PRDX5-E80K in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationE80KPromoterCMVAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K83R-VA
Plasmid#98690PurposeLentiviral expression of human PRDX5-K83R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK83RPromoterCMVAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307-SOD1E133K
Plasmid#83447PurposeMammalian expression of SOD1E133KDepositorInsertSOD1 (SOD1 Human)
UseLentiviralTagsExpressionMammalianMutationE133KPromoterAvailable sinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSOD1E133insTT-AcGFP1
Plasmid#83441PurposeExpresses SOD1E133insTT in mammalian cells.DepositorInsertSOD1 (SOD1 Human)
UseTagsAcGFP1ExpressionMammalianMutationE133insTTPromoterCMVAvailable sinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSOD1E133Δ-AcGFP1
Plasmid#83419PurposeExpresses SOD1E133Δ in mammalian cells.DepositorInsertSOD1 (SOD1 Human)
UseTagsAcGFP1ExpressionMammalianMutationE133 deletionPromoterCMVAvailable sinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
COVID-SARS2 NSP14/10
Plasmid#159613PurposeBacterial co-expression vector fo Covid-SARS2 NSP14 and NSP10DepositorInsertsUseTagsHis6, TEV cleavage site and noneExpressionBacterialMutationCodon-optimized for E. coli expressionPromoter(Bicistronic) and T7 - LacOAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS40P
Plasmid#35481DepositorTypeEmpty backboneUseYeast integrating vectorTagsExpressionMutationPromoterAvailable sinceNov. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
lvl0 BlpR
Plasmid#153390PurposeConfers resistance to bialaphos or phosphinothricin (Glufosinate)DepositorInsertBlpR
UseTagsExpressionPlantMutationPromoterAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNFkB:eGFP
Plasmid#44922DepositorInsertEGFP
UseTagsExpressionMutationPromoterAvailable sinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
P[acman]-Alpha2
Plasmid#165859PurposeAlpha2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Omega2
Plasmid#165861PurposeOmega2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha1
Plasmid#165858PurposeAlpha1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Omega1
Plasmid#165860PurposeOmega1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-msfGFP
Plasmid#194913PurposeTetracycline inducible expression of msfGFP in StaphylococciDepositorInsertShine Dalgarno Sequence followed by monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…TagsExpressionBacterialMutationPromoterAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-tat:msfGFP
Plasmid#194915PurposeTetracycline inducible expression of msfGFP fused to Tat signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Tat signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…TagsExpressionBacterialMutationPromoterAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-sec:msfGFP
Plasmid#194914PurposeTetracycline inducible expression of msfGFP fused to Sec signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…TagsExpressionBacterialMutationPromoterAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMB41
Plasmid#73087PurposeN-terminal Avi-2xTEV-GFP vector, for fosmid recombineeringDepositorInsertAvi-GFP tag
UseTagsAvi and GFPExpressionWormMutationPromoterAvailable sinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMB72
Plasmid#73088PurposeC-terminal GFP-2xTEV-Avi vector, for fosmid recombineeringDepositorInsertGFP-Avi tag
UseTagsGFP and AviExpressionWormMutationPromoterAvailable sinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGem-LP1-loxP-bar-lox2272-71
Plasmid#168785PurposeVector to create landing pad 1 (LP1) by homologous recombination in Aspergillus nidulans ΔSt site. The strain A. nidulans LP1 is used for recombinase mediated chromosomal integration.DepositorInsertsbar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
loxP
lox2272-71
UseCre/Lox and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGem-LP2-loxP-bar-lox2272-71
Plasmid#168786PurposeVector to create landing pad 2 (LP2) by homologous recombination in Aspergillus nidulans IS1 site. The strain A. nidulans LP2 is used for recombinase mediated chromosomal integration.DepositorInsertsbar
IS1 Homology arm 1
IS1 Homology arm 2
loxP
lox2272-71
UseCre/Lox and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
UseTagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable sinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pC-BAR-YR
Plasmid#61766PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing bar gene (for resistance against glufosinate ammonium) on transfer DNA (TDNA).DepositorInsertsBar gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…TagsExpressionMutationPromotertrpC promoterAvailable sinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
Minimal Antibiotic Resistance Platform (ARP)
Plasmid Kit#1000000143PurposeUsed for the general dereplication of antibiotics in natural product extracts. Plasmids constitutively express individual resistance genes that target the most commonly found antibiotics.DepositorAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
RAS Pathway 2.0 Clone Collection
Plasmid Kit#1000000070PurposeCollection contains 180 genes in the âRAS pathway version 2.0â, a crowdsourced pathway map of the RAS signaling pathway; For use with Gateway cloning or FNLCR Combinatorial Cloning PlatformDepositorAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.CaMPARI.WPRE.SV40 (AAV9)
Viral Prep#100832-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.hSyn.CaMPARI.WPRE.SV40 (#100832). In addition to the viral particles, you will also receive purified pAAV.hSyn.CaMPARI.WPRE.SV40 plasmid DNA. Synapsin-driven, photoconvertible (irreversible green-to-red) calcium integrator. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.CaMPARI.WPRE.SV40 (AAV1)
Viral Prep#100832-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.hSyn.CaMPARI.WPRE.SV40 (#100832). In addition to the viral particles, you will also receive purified pAAV.hSyn.CaMPARI.WPRE.SV40 plasmid DNA. Synapsin-driven, photoconvertible (irreversible green-to-red) calcium integrator. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.CaMPARI.WPRE.SV40 (AAV5)
Viral Prep#100832-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.hSyn.CaMPARI.WPRE.SV40 (#100832). In addition to the viral particles, you will also receive purified pAAV.hSyn.CaMPARI.WPRE.SV40 plasmid DNA. Synapsin-driven, photoconvertible (irreversible green-to-red) calcium integrator. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST (AAV9)
Viral Prep#174007-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST (#174007). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8s and soma-targeted ChrimsonR. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV1)
Viral Prep#83899-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsNoneAvailable sinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV9)
Viral Prep#83899-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsNoneAvailable sinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (AAV9)
Viral Prep#83897-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (#83897). In addition to the viral particles, you will also receive purified pAAV-hDlx-GqDREADD-dTomato-Fishell-4 plasmid DNA. hDlx-driven expression of GqDREADD (hM3D) and nuclear localized dTomato (physically separate) for activation of interneurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhDlxTagsdTomatoAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-GiDREADD-dTomato-Fishell-5 (AAV9)
Viral Prep#83896-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hDlx-GiDREADD-dTomato-Fishell-5 (#83896). In addition to the viral particles, you will also receive purified pAAV-hDlx-GiDREADD-dTomato-Fishell-5 plasmid DNA. hDlx-driven expression of Gi-DREADD and nuclear localized dTomato (physically separate). These AAV preparations are suitable purity for injection into animals.DepositorPromoterhDlxTagsdTomato (physically separate, not a fusion protein)Available sinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1 (AAV9)
Viral Prep#83900-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-GFP-Fishell-1 (#83900). In addition to the viral particles, you will also receive purified pAAV-mDlx-GFP-Fishell-1 plasmid DNA. mDlx-driven expression of GFP in GABA-ergic interneurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsGFPAvailable sinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1 (AAV1)
Viral Prep#83900-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-mDlx-GFP-Fishell-1 (#83900). In addition to the viral particles, you will also receive purified pAAV-mDlx-GFP-Fishell-1 plasmid DNA. mDlx-driven expression of GFP in GABA-ergic interneurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsGFPAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-ChR2-mCherry-Fishell-3 (AAV9)
Viral Prep#83898-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-ChR2-mCherry-Fishell-3 (#83898). In addition to the viral particles, you will also receive purified pAAV-mDlx-ChR2-mCherry-Fishell-3 plasmid DNA. mDlx-driven expression of ChR2, fused to mCherry. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsmCherryAvailable sinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1 (AAV2)
Viral Prep#83900-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-mDlx-GFP-Fishell-1 (#83900). In addition to the viral particles, you will also receive purified pAAV-mDlx-GFP-Fishell-1 plasmid DNA. mDlx-driven expression of GFP in GABA-ergic interneurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsGFPAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-Flex-dTomato-Fishell_7 (AAV9)
Viral Prep#83894-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hDlx-Flex-dTomato-Fishell_7 (#83894). In addition to the viral particles, you will also receive purified pAAV-hDlx-Flex-dTomato-Fishell_7 plasmid DNA. hDlx-driven, Cre-dependent expression of dTomato. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhDlxTagsdTomato (Cre-dependent)Available sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-ChR2-mCherry-Fishell-3 (AAV1)
Viral Prep#83898-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-mDlx-ChR2-mCherry-Fishell-3 (#83898). In addition to the viral particles, you will also receive purified pAAV-mDlx-ChR2-mCherry-Fishell-3 plasmid DNA. mDlx-driven expression of ChR2, fused to mCherry. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsmCherryAvailable sinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (AAV1)
Viral Prep#83897-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (#83897). In addition to the viral particles, you will also receive purified pAAV-hDlx-GqDREADD-dTomato-Fishell-4 plasmid DNA. hDlx-driven expression of GqDREADD (hM3D) and nuclear localized dTomato (physically separate) for activation of interneurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhDlxTagsdTomatoAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-Flex-GFP-Fishell_6 (AAV9)
Viral Prep#83895-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hDlx-Flex-GFP-Fishell_6 (#83895). In addition to the viral particles, you will also receive purified pAAV-hDlx-Flex-GFP-Fishell_6 plasmid DNA. hDlx-driven, Cre-dependent expression of GFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhDlxTagsGFP (Cre-dependent)Available sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only