-
Plasmid#139455PurposeLentiviral vector with non-targeting gRNA and puromycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-CTRLg2 (CG510)
Plasmid#139456PurposeLentiviral vector with non-targeting gRNA and puromycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6-LSL (Cre dependent)Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2ExpressionMutationPromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
MTK0_004
Plasmid#123961PurposeEncodes the Cas9 cROSA26 homology destination with Blasticidin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInsertcRosa26 destination
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP114
Plasmid#120799PurposeE. coli-C. difficile shuttle vector for xylose-inducible expression in C. difficile; Pxyl driving expression of red fluorescent protein (mCherryOpt)DepositorInsertPxyl::mCherryOpt
UseTagsExpressionBacterialMutation1.4 kb xylR-Pxyl DNA fragment from C. difficile R…PromoterPxylAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEN396 - pCAGGS-Tir1-V5-2A-PuroR TIGRE donor
Plasmid#92142PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection (2A-fusion). Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianMutationPromoterAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN114 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-PuroR-bpA-Frt-Rosa26
Plasmid#92143PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse Rosa26 locus using Puromycin selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianMutationPromoterAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-FNLS(RA)
Plasmid#112671PurposeCMV expression vector for BE3-FNLS construct (codon optimized)DepositorInsertBE3-FNLS
UseTags3x FLAGExpressionMammalianMutationNLS sequence at the N-terminus and D10APromoterCMVAvailable sinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Fuw-AcrIIA4-P2A-GFP
Plasmid#108247PurposeLentiviral vector to express AcrIIA4-P2A-GFPDepositorInsertAcrIIA4-NLS-HA (NEWENTRY Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationPromoterUbcAvailable sinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-2X
Plasmid#110835PurposeCMV expression vector for BE3-2X construct (not codon optimized)DepositorInsertBE3-2X
UseTagsExpressionMammalianMutation2 tandem NLS sequences in the XTEN linkerPromoterCMVAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-FNLS
Plasmid#110836PurposeCMV expression vector for BE3-FNLS construct (not codon optimized)DepositorInsertBE3-FNLS
UseTags3X FLAGExpressionMammalianMutationNLS sequence at the N-terminusPromoterCMVAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
hSyn-GW-dCas9-SET2-R195G-C201A-IRES2-mCherry
Plasmid#202090PurposeNeuron-specific expression vector of catalytically-dead dCas9-Set2 containing R195G and C201A mutationsDepositorInsertdCas9-Set2(R195G, C201A)
UseTags3x FLAG and mCherryExpressionMammalianMutationR195G and C201A abolish catalytic activityPromoterhuman SynapsinAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQnl_tet
Plasmid#191355PurposeClostridium expression vector with TetR-repressed NanoLuc expressionDepositorInsertPGusA2-TetO2/1-Nanoluc, miniPthl-tetR cassette
UseTagsExpressionBacterialMutationPromoterPGus2A-TetO2/1Available sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod2C-GG
Plasmid#191347PurposeClostridium expression vector (pBP1 origin, cmR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pATmin-GG
Plasmid#191352PurposeClostridium expression vector (pAMB1 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
UseTagsExpressionBacterialMutationPromoterPlacAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only