Circular 200,100 (mPCSK9)
(Plasmid
#170122)
-
PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promoters
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepZac2.1
-
Backbone manufacturerAddgene #78601
- Backbone size w/o insert (bp) 5700
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCircular 200,100 guide RNA
-
gRNA/shRNA sequenceGCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCTAACCATGCCGACTGATGGCAGAAAAAAAAAACTTCCTGAAAGACAAATACACCCTAAGGCCTGAGAACTGAGGCCTTGCAGCGAGCATCCTCAGGTTCTGGTACACTGGAGCAGCTGGCCAGAGCCAGCCACAGCTTAATGTCTGATGGCAGAAAGCCAAGCACAGGCCCCCTGACCGTGAAGGAGGTGCTTCCATACACCAGGAATGGGTACCCAGGGTGAGACACCAAAAAAAAAACTGCCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC
-
SpeciesM. musculus (mouse)
-
Entrez GenePcsk9 (a.k.a. AI415265, AI747682, FH3, HCHOLA3, Narc1, PC9)
- Promoter Human U6 and mouse U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Circular 200,100 (mPCSK9) was a gift from Prashant Mali (Addgene plasmid # 170122 ; http://n2t.net/addgene:170122 ; RRID:Addgene_170122) -
For your References section:
Efficient in vitro and in vivo RNA editing via recruitment of endogenous ADARs using circular guide RNAs. Katrekar D, Yen J, Xiang Y, Saha A, Meluzzi D, Savva Y, Mali P. Nat Biotechnol. 2022 Feb 10. pii: 10.1038/s41587-021-01171-4. doi: 10.1038/s41587-021-01171-4. 10.1038/s41587-021-01171-4 PubMed 35145312