-
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorInsertC-C chemokine receptor type 5 (CCR5 Human)
UseTagsExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Flrt3 [N353/13R]
Plasmid#114486PurposeMammalian Expression Plasmid of anti-Flrt3 (Mouse). Derived from hybridoma N353/13.DepositorInsertanti-Flrt3 (Mus musculus) recombinant mouse monoclonal antibody (Flrt3 Mouse)
UseTagsExpressionMammalianMutationPromoterdual CMVAvailable sinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_FBXO15_WT
Plasmid#81839PurposeGateway Donor vector containing FBXO15 , part of the Target Accelerator Plasmid Collection.DepositorInsertFBXO15 (FBXO15 Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_FBXO15_p.E410K
Plasmid#81405PurposeGateway Donor vector containing FBXO15 , part of the Target Accelerator Plasmid Collection.DepositorInsertFBXO15 (FBXO15 Human)
UseGateway entry vectorTagsExpressionMutationE410KPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-Malat1
Plasmid#216858PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing Malat1 at the synapse. CIRTS-YTHDF2-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-Malat1 gRNA
UseLentiviralTagsGFPExpressionMammalianMutationPromoterSyn1, U6Available sinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-CDC20
Plasmid#221694PurposeMammalian expression of FLAG-tagged human CDC20DepositorInsertCDC20 (CDC20 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Basigin
Plasmid#221415PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertBasigin (BSG Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1
Plasmid#169831PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids F1366 - P1376; TCCC ->…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1 and Loop2
Plasmid#169833PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 and F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletions of amino acids R1398 - S1407 and F1366 …PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-FTO-Malat1
Plasmid#216860PurposeCIRTS RNA targeting system for targeted removal of m6A on Malat1 at the synapse. CIRTS-FTO-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-FTO-Calm3-U6-Malat1 gRNA
UseLentiviralTagsExpressionMammalianMutationPromoterSyn1, U6Available sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-FTO-control
Plasmid#216859PurposeCIRTS RNA targeting system for targeted removal of m6A on transcript at the synapse. CIRTS-FTO-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-FTO-Calm3-U6-control gRNA
UseLentiviralTagsmCherry2ExpressionMammalianMutationPromoterSyn1, U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ρ1-EM GABAA receptor in pEZT-BM
Plasmid#213072PurposeExpress human GABA-A rho1 receptor with truncated intracellular domain and superfolder GFP insertion in ICDDepositorInsertHuman GABAa rho1 receptor (GABRR1 Human)
UseBacmam, baculovirus, oocyte expressionTagsTwin-Strep tag and superfolderGFPExpressionMammalianMutationEncodes residues S58–L383 and D451–S479, separate…PromoterCMV and T7Available sinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ARID1A(42))-PGKpuro2ABFP-W
Plasmid#200467PurposeLentiviral vector expressing gRNA targeting human ARID1ADepositorInsertARID1A(42) (ARID1A Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ARID1A(44))-PGKpuro2ABFP-W
Plasmid#200468PurposeLentiviral vector expressing gRNA targeting human ARID1ADepositorInsertARID1A(44) (ARID1A Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-BSG-COMP5AP-AviTag-9xHis
Plasmid#157306PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertBSG (BSG Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-IL18R1-Fc(DAPA)-AviTag-6xHis
Plasmid#156749PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertIL18R1 (IL18R1 Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
GABA(A)R, Alpha2 scFv [N399/19]
Plasmid#190552PurposeMammalian Expression of GABA(A)R, Alpha2 scFV. Derived from hybridoma N399/19.DepositorInsertGABA(A)R, Alpha2 (Rattus norvegicus) recombinant scFV (Gabra2 Mouse)
UseTagsHA, Sortase, 6xHisExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only