pCDH-V1-rCD20-BSD
(Plasmid #209752)

• Purpose: To reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.
• Depositing Lab: Andrei Thomas-Tikhonenko
• Publication: Ang et al Blood. 2023 Sep 8:blood.2023020400. doi: 10.1182/blood.2023020400.

Backbone

• Vector backbone: pCDH-IRES-BSD
• Backbone size w/o insert (bp): 7456
• Vector type: Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MS4A1
• Species: H. sapiens (human)
• Mutation: The CCTGGGGGGTCTTCTGATGATCC sequence within the CDS of CD20 was mutated to GTTGGGCGGACTACTTATGATTC to confer resistance to the CD20-targeting gRNA from the LentiCRISPRv2-sgCD20 vector.
• Entrez Gene: MS4A1 (a.k.a. B1, Bp35, CD20, CVID5, FMC7, LEU-16, S7)

Cloning Information

• Cloning method: Gibson Cloning

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.