We narrowed to 18,244 results for: sgRNA
-
Plasmid#177183Purposeplasmid expressing an sgRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the PEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDAS12137_sgRNA-PEAR-GFP-nick(+17)-mCherry
Plasmid#177183Purposeplasmid expressing an sgRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the PEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Blast
Plasmid#199622PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and blasticidin resistance from EF-1a promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Blast
Plasmid#199622PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and blasticidin resistance from EF-1a promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-mCherry-MLKL
Plasmid#75167PurposeLentiCRISPR-mCherry with sgRNA targeting human MLKLDepositorInsertMLKL sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLC-mCherry-MLKL
Plasmid#75167PurposeLentiCRISPR-mCherry with sgRNA targeting human MLKLDepositorInsertMLKL sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-RRBP1-1
Plasmid#92156PurposeCRISPR guide RNA targeting human RRBP1DepositorInsertRRBP1 sgRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-RRBP1-1
Plasmid#92156PurposeCRISPR guide RNA targeting human RRBP1DepositorInsertRRBP1 sgRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBHM2616
Plasmid#234495PurposeHYGR-CnU6-empty sgRNADepositorInsertHYG-PCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T1_gRNA
Plasmid#199387PurposepDEL111; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type I sgRNADepositorInsertnrg1 type I sgRNA
UseTol2 destination vectorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T2_gRNA
Plasmid#199388PurposepDEL112; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type II sgRNADepositorInsertnrg1 type II sgRNA
UseTol2 destination vectorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T3_gRNA
Plasmid#199389PurposepDEL113; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type III sgRNADepositorInsertnrg1 type III sgRNA
UseTol2 destination vectorAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sp(AU)sgRNA-mKO2
Plasmid#184443PurposesgRNA with AU flip (sgRNA2.0), mKO2 as selection markerDepositorInsertsgRNA with AU flip, mKO2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBHM2616
Plasmid#234495PurposeHYGR-CnU6-empty sgRNADepositorInsertHYG-PCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T1_gRNA
Plasmid#199387PurposepDEL111; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type I sgRNADepositorInsertnrg1 type I sgRNA
UseTol2 destination vectorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T2_gRNA
Plasmid#199388PurposepDEL112; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type II sgRNADepositorInsertnrg1 type II sgRNA
UseTol2 destination vectorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest_U6_A2_CG2_T3_gRNA
Plasmid#199389PurposepDEL113; Gateway Destination vector for cell-type specific CRISPR encoding nrg1 type III sgRNADepositorInsertnrg1 type III sgRNA
UseTol2 destination vectorAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sp(AU)sgRNA-mKO2
Plasmid#184443PurposesgRNA with AU flip (sgRNA2.0), mKO2 as selection markerDepositorInsertsgRNA with AU flip, mKO2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only