-
Plasmid#106313PurposeExpress Cas9 and sgRNA targeting MTHFD2DepositorInsertsgRNA targeting MTHFD2 (MTHFD2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No3
Plasmid#194898PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-3 targeting the promoter of human MECP2DepositorInsertsgRNA targeting human MECP2 promoter No.3
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No9
Plasmid#194903PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-9 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.9
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-mCherry-MLKL
Plasmid#75167PurposeLentiCRISPR-mCherry with sgRNA targeting human MLKLDepositorInsertMLKL sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1_Neo
Plasmid#125593PurposeLentiviral expression of sgRNA with GFP and neomycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for sgRNA expression and EFS promoter…Available sinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0750
Plasmid#185627PurposeModified tobacco rattle virus RNA2 acceptor vector that could be used for expression of sgRNAs, contains restriction enzyme sites for golden gate assembly using AarIDepositorInsertlacZ
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330-CD4
Plasmid#136938PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human CD4; induce CD4+ deletion rearrangement by pairing w/ px330-GAPDHDepositorInsertsgRNA targeting CD4 (CD4 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair2
Plasmid#98973PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 96bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 2 and Cas9(D10A)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAT-9208
Plasmid#124221PurposeCloning plasmid for a self-targeting gRNA libraryDepositorInsertself-targeting gRNA
UseCRISPRTagsExpressionBacterialMutationPromoterJ23119Available sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-HA-dSpCas9
Plasmid#92112PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9
UseCRISPRTagsHA tag and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9
Plasmid#92113PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre stuffer v3
Plasmid#158030Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA casette (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti CRISPR sgSHMT2_1
Plasmid#106308PurposeExpress Cas9 and sgRNA targeting SHMT2DepositorInsertsgRNA targeting SHMT2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
HeFm2SpCas9
Plasmid#92111PurposeExpression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence)DepositorInsert“Highly enhanced Fidelity” mut2 SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, R1060APromoterCbhAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0761
Plasmid#185630PurposeModified tobacco rattle virus RNA2 vector expressing an sgRNA fused to trucated flowering locus T which targets phytoene desaturase (PDS) of Nicotiana benthamiana, functionally equivalent to pEE393DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only