Showing: 2161 - 2180 of 3245 results
-
Plasmid#217733PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG2 (ADGRG2 Human)
UseTagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-612PromoterAvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG6 CTFdeltaTA-FLAG
Plasmid#217737PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGR6 (ADGRG6 Human)
UseTagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-846PromoterAvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRL2 CTFdeltaTA-FLAG
Plasmid#217740PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRL2 (ADGRL2 Human)
UseTagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-830PromoterAvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRV1 CTFdeltaTA-FLAG
Plasmid#217743PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRV1 (ADGRV1 Human)
UseTagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-5896PromoterAvailabilityAcademic Institutions and Nonprofits only -
pITESceIcmd
Plasmid#218288PurposeIntroduction of a cyanamide-inducible I-SceI expression cassette, use in combination with pITEdv1DepositorInsertHO(-253, -1)-tSynth3UseTagsExpressionYeastMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
tet-TadA8e-PcrA M6-UGI-PGK-Puro-T2A-rtTA
Plasmid#221235PurposeTet-inducible lentiviral HACE Editor as a fusion of TadA-8e adenosine deaminase and an optimized PcrA M6 helicase.DepositorInsertTadA8e-PcrA M6-UGI-PGK-Puro-T2A-rtTA
UseLentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorInsertgRNA targeting human Rab7A (RAB7A Human)
UseTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1A-Puro-mCherry-RAB7-S72A
Plasmid#221556PurposeExpresses Cherry-tagged human Rab7 with S72A mutation in mammalian cells. Compatible with piggybac transposase for genome integration.DepositorInsertRab7A (RAB7A Human)
UsePiggybacTagsmCherryExpressionMammalianMutationChange serine 72 to alaninePromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
FKBP-LBR(1-245)-GFP
Plasmid#222425PurposeTo express a truncated LBR (encoding amino acids 1-245) with N-terminal FKBP tag accessible to the cytoplasm and C-terminal GFP in mammalian cellsDepositorInsertLBR(1-245aa) (LBR Human)
UseTagsFKBP and GFPExpressionMammalianMutationTruncation (Includes aa 1-245)PromoterAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-30-picky_sticky
Plasmid#138983PurposeIVT template for the alpha subunit of the mouse TCR #30 that is reactive against MC38DepositorInsertTCRA (Tcra Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-30-picky_sticky
Plasmid#138984PurposeIVT template for the beta subunit of the mouse TCR #30 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-31-murderous_crow
Plasmid#138985PurposeIVT template for the alpha subunit of the mouse TCR #31 that is reactive against MC38DepositorInsertTCRA (Tcra Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-31-murderous_crow
Plasmid#138986PurposeIVT template for the beta subunit of the mouse TCR #31 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-32-riot_punisher
Plasmid#138987PurposeIVT template for the alpha subunit of the mouse TCR #32 that is reactive against MC38DepositorInsertTCRA (Tcra Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-32-riot_punisher
Plasmid#138988PurposeIVT template for the beta subunit of the mouse TCR #32 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-33-MC_hammer
Plasmid#138989PurposeIVT template for the alpha subunit of the mouse TCR #33 that is reactive against MC38DepositorInsertTCRA (Tcra Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-33-MC_hammer
Plasmid#138990PurposeIVT template for the beta subunit of the mouse TCR #33 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pGlomyc-Grhl3
Plasmid#172869PurposeMammalian expression vector with myc-tagged mouse Grhl3 coding sequenceDepositorInsertGrhl3 (Grhl3 Mouse)
UseTagsmycExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 2161 - 2180 of 3245 results