Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
216318 pAAV2.1-CMV-5'Cer-BDlacZ-bGHpA split cerulean fluorescent protein + splice donor site (Synthetic) Becirovic Mar 25, 2024
214667 pAAV_MLP-BC0252-luc2 Adenovirus major late promoter (MLP) with barcode 0252 (Synthetic) Wehr Mar 25, 2024
214670 pAAV_MLP-BC1405-luc2 Adenovirus major late promoter (MLP) with barcode 1405 (Synthetic) Wehr Mar 25, 2024
214669 pAAV_MLP-BC1403-luc2 Adenovirus major late promoter (MLP) with barcode 1403 (Synthetic) Wehr Mar 25, 2024
214668 pAAV_MLP-BC0253-luc2 Adenovirus major late promoter (MLP) with barcode 0253 (Synthetic) Wehr Mar 25, 2024
214649 pGL4_EGR1p-BC1485-luc2 EGR1 promoter with barcode 1485 (Synthetic) Wehr Mar 25, 2024
214634 pGL4_10xUAS-CMVmin-BC0427-luc2 10x clustered UAS element with barcode 0427 (Synthetic) Wehr Mar 25, 2024
214646 pGL4_EGR1p-BC0130-luc2 EGR1 promoter with barcode 0130 (Synthetic) Wehr Mar 25, 2024
214648 pGL4_EGR1p-BC0143-luc2 EGR1 promoter with barcode 0143 (Synthetic) Wehr Mar 25, 2024
214619 pGL4_10xUAS-CMVmin-BC0376-luc2 10x clustered UAS element with barcode 0376 (Synthetic) Wehr Mar 25, 2024
214620 pGL4_10xUAS-CMVmin-BC0382-luc2 10x clustered UAS element with barcode 0382 (Synthetic) Wehr Mar 25, 2024
214621 pGL4_10xUAS-CMVmin-BC0383-luc2 10x clustered UAS element with barcode 0383 (Synthetic) Wehr Mar 25, 2024
214622 pGL4_10xUAS-CMVmin-BC0385-luc2 10x clustered UAS element with barcode 0385 (Synthetic) Wehr Mar 25, 2024
214623 pGL4_10xUAS-CMVmin-BC0386-luc2 10x clustered UAS element with barcode 0386 (Synthetic) Wehr Mar 25, 2024
214637 pGL4_CRE-CMV-BC0484-luc2 6x clustered CRE element with barcode 0484 (Synthetic) Wehr Mar 25, 2024
214618 pGL4_10xUAS-CMVmin-BC0374-luc2 10x clustered UAS element with barcode 0374 (Synthetic) Wehr Mar 25, 2024
214659 pGL4_NFAT-RE-CMV-BC0529-luc2 6x clustered NFAT element with barcode 0529 (Synthetic) Wehr Mar 25, 2024
214662 pGL4_NFAT-RE-CMV-BC0537-luc2 6x clustered NFAT element with barcode 0537 (Synthetic) Wehr Mar 25, 2024
214651 pGL4_EGR1p-BC1487-luc2 EGR1 promoter with barcode 1487 (Synthetic) Wehr Mar 25, 2024
211115 pUC19-Top2A-5X Gly-Venus-T2A-Hygro 5' C-term Top2A homology arm (Homo sapiens), Venus (Other), T2A (Synthetic), Blastocidin Resistance (Other), 5' C-term Top2A homology arm (Homo sapiens) Dekker Mar 25, 2024
206980 SpIMPDH SpIMPDH (Other) Schramm Mar 25, 2024
215624 pGal4-DBD-OCT4_AroPERFECT_N OCT4 AroPERFECT N (Homo sapiens) Hnisz Mar 25, 2024
195560 pBaseline-PRM-wasabi mWasabi (Synthetic) Shapiro Mar 25, 2024
195557 pTcI39-switch mRFP1 (Synthetic), mWasabi (Synthetic), TcI39 (Other) Shapiro Mar 25, 2024
195555 pTcI39-PRM-wasabi mWasabi (Synthetic), TcI39 (Other) Shapiro Mar 25, 2024
195554 pTcI38-PRM-wasabi mWasabi (Synthetic), TcI38 (Other) Shapiro Mar 25, 2024
195553 pCIwt-PRM-Wasabi mWasabi (Synthetic), CIwt (Other) Shapiro Mar 25, 2024
215691 pcDNAintron-LASV-GPC-HA-c3xFLAG LASV GP-HA-FLAG (Other) Brindley Mar 25, 2024
215692 pcDNAintron-EBOV-GP EBOV-GP (Other) Brindley Mar 25, 2024
215689 pcDNAintron-LASV-GPC-c3xFLAG LASV GP-FLAG (Other) Brindley Mar 25, 2024
215693 pcDNAintron-XKR8-n3xFLAG XKR8-n3xFLAG (Homo sapiens) Brindley Mar 25, 2024
215690 pcDNAintron-LASV-GPC LASV GP (Other) Brindley Mar 25, 2024
215675 pMS18 eef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG (Caenorhabditis elegans) Phillips Mar 25, 2024
215676 pMS62 eef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG (Caenorhabditis elegans) Phillips Mar 25, 2024
215683 pMS161 U6p::GTCCAGCGGCAGATCGGCGG (Synthetic) Phillips Mar 25, 2024
215674 pMS110 5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA (Caenorhabditis elegans) Phillips Mar 25, 2024
204018 pUC-mini-NFKB1-PGK-EGFP EGFP Sato Mar 25, 2024
204019 pUCmini-NFKB1-PGK-tdTomato tdTomato Sato Mar 25, 2024
204020 pUCmini-NFKB2-PGK-EGFP EGFP Sato Mar 25, 2024
204021 pUCmini-NFKB2-PGK-tdTomato tdTomato Sato Mar 25, 2024
193658 pCMV-RVR-A3A-Y130F RVR-dLbCas12a-hA3A-Y130F, EGFP (Synthetic) Lai Mar 25, 2024
198338 PB-Ef1a-SunTag-RPS7-PP7-WPRE GCN4x24-RPS7-3'UTR-PP7 stem loops x24 (Homo sapiens) Ward Mar 25, 2024
198339 PB-Ef1a-RPS27A-UTR-PP7-WPRE RPS27A-3'UTR-PP7 stem loops x24 (Homo sapiens) Ward Mar 25, 2024
208188 pSC101-GFPmut2-mScarlet-I TAG GFPmut2 (Synthetic), mScarlet-I (Synthetic) Tenson Mar 25, 2024
208189 pSC101-GFPmut2-mScarlet-I TGA GFPmut2 (Synthetic), mScarlet-I (Synthetic) Tenson Mar 25, 2024
208190 pSC101-GFPmut2-mScarlet-I TGATC GFPmut2 (Synthetic), mScarlet-I (Synthetic) Tenson Mar 25, 2024
208191 pSC101-GFPmut2-mScarlet-I T7 GFPmut2 (Synthetic), mScarlet-I (Synthetic) Tenson Mar 25, 2024
208192 pSC101-GFPmut2-mScarlet-I A5 GFPmut2 (Synthetic), mScarlet-I (Synthetic) Tenson Mar 25, 2024
208193 pSC101-GFPmut2-mScarlet-I A4 GFPmut2 (Synthetic), mScarlet-I (Synthetic) Tenson Mar 25, 2024
208194 pSC101-GFPmut2-mScarlet-I A6T GFPmut2 (Synthetic), mScarlet-I (Synthetic) Tenson Mar 25, 2024