|
|
215115 |
SS-Cyclin D2 |
CCND2 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
215052 |
EGFP-Cyclin D3 |
CCND3 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
213111 |
pkk223_Null |
No insert
|
Horvath |
Apr 09, 2024 |
|
|
213110 |
pkk223_EcMutY |
MutY (adenine glycosylase) (Other)
|
Horvath |
Apr 09, 2024 |
|
|
214768 |
pMSCV-IRES-mOrange/CALR del52 |
human CALR del52 (Homo sapiens)
|
Komatsu |
Apr 09, 2024 |
|
|
214767 |
pMSCV-IRES-GFP/CREB3L1 |
CREB3L1 (Homo sapiens)
|
Komatsu |
Apr 09, 2024 |
|
|
214769 |
pMSCV-IRES-mOrange/CALR ins5 |
human CALR ins5 (Homo sapiens)
|
Komatsu |
Apr 09, 2024 |
|
|
214807 |
pMSCV-IRES-mOrange |
|
Komatsu |
Apr 09, 2024 |
|
|
214356 |
pAAV-SlugABE-NNG |
SlugABE-NNG (Synthetic)
|
Wang |
Apr 09, 2024 |
|
|
212613 |
Noodles Plasmid |
|
Vinnikov |
Apr 09, 2024 |
|
|
217342 |
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1) |
crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens)
|
Gilbert |
Apr 09, 2024 |
|
|
214990 |
mNeonGreen-P2A-3xFLAG-msEEA1 HDR template |
EEA1 (Mus musculus)
|
Harper |
Apr 09, 2024 |
|
|
214209 |
pDSG467 |
AraC, trpC
|
Alon |
Apr 09, 2024 |
|
|
214983 |
pLV UBC APEX2-3xFLAG-IRES-eGFP |
APEX2 (Other)
|
Harper |
Apr 09, 2024 |
|
|
214998 |
hTMEM115-TEV-3xHA-P2A-mScarlet HDR template |
hTMEM115-TEV-3xHA-P2A-mScarlet HDR template (Homo sapiens)
|
Harper |
Apr 09, 2024 |
|
|
213928 |
PBbtCRISPRko.v1 |
na
|
Tan |
Apr 09, 2024 |
|
|
213927 |
LV2btCRISPRko.v1 |
na
|
Tan |
Apr 09, 2024 |
|
|
214999 |
hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template |
hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template (Homo sapiens)
|
Harper |
Apr 09, 2024 |
|
|
215000 |
pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template |
msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template (Mus musculus)
|
Harper |
Apr 09, 2024 |
|
|
217376 |
Lenti-mApple-6xHp |
mApple-6x Hp NC (Homo sapiens)
|
Chang |
Apr 09, 2024 |
|
|
212694 |
pCfB10769 |
gRNA targeting to the intergradtion site E2 (Other)
|
Borodina |
Apr 09, 2024 |
|
|
216503 |
pcDNA3 Ras-LOCKR-PL Key |
Ras-LOCKR-PL Key (Homo sapiens)
|
Baker |
Apr 09, 2024 |
|
|
216502 |
pcDNA3 Ras-LOCKR-PL Cage |
Ras-LOCKR-PL Cage (Homo sapiens)
|
Baker |
Apr 09, 2024 |
|
|
216497 |
pcDNA3 Ras-LOCKR-S R89L (negative control) |
Ras-LOCKR-S R89L negative control (Homo sapiens)
|
Baker |
Apr 09, 2024 |
|
|
216496 |
pcDNA3 Ras-LOCKR-S |
Ras-LOCKR-S (Homo sapiens)
|
Baker |
Apr 09, 2024 |
|
|
214467 |
pHelper_TS_V2_ampR |
CspRecT / Bxb-1 (Synthetic)
|
Saunders |
Apr 09, 2024 |
|
|
213903 |
pDonor_Tn[GFP] |
mariner transposon with kan resistance and mNeonGreen (Synthetic)
|
Collins |
Apr 09, 2024 |
|
|
140576 |
CaV1.2/pcDNA3.1~ Human |
human CaV1.2 (Homo sapiens)
|
Minor |
Apr 09, 2024 |
|
|
211537 |
pLenti-GFP-2A-Puro-gATRIP_A |
sgRNA ATRIP (Synthetic)
|
Sfeir |
Apr 09, 2024 |
|
|
208322 |
pET28b-PunyEEER |
PunyERRE (Synthetic)
|
Beatty |
Apr 09, 2024 |
|
|
217381 |
pYH71 |
mcdB (Synthetic)
|
Vecchiarelli |
Apr 09, 2024 |
|
|
217618 |
Human FLAG-WDR20 |
WDR20 (Homo sapiens)
|
Lee |
Apr 09, 2024 |
|
|
217628 |
MBP-C5E-6XTUBE |
6XTUBE (Other)
|
Lee |
Apr 09, 2024 |
|
|
213721 |
psgRNA-GST-EGFP-GPICEAM7 |
EGFP (Homo sapiens)
|
Huang |
Apr 09, 2024 |
|
|
215137 |
mCherry-PNKP |
PNKP (Homo sapiens)
|
Pagano |
Apr 09, 2024 |
|
|
215148 |
pTRIPZ-FFSS-Cyclin D1 |
CCND1 (Homo sapiens)
|
Pagano |
Apr 09, 2024 |
|
|
215489 |
FUW-hSNCA-GFP |
alpha-synuclein (Homo sapiens)
|
Shalem |
Apr 09, 2024 |
|
|
215488 |
FUW-hSNCA(D2E)-NE |
alpha-synuclein (Homo sapiens)
|
Shalem |
Apr 09, 2024 |
|
|
215487 |
FUW-hSNCA(D2R)-NE |
alpha-synuclein (Homo sapiens)
|
Shalem |
Apr 09, 2024 |
|
|
215486 |
FUW-hSNCA-NE |
alpha-synuclein (Homo sapiens)
|
Shalem |
Apr 09, 2024 |
|
|
215491 |
FUW-hSNCA(D2E)-GFP |
alpha-synuclein (Homo sapiens)
|
Shalem |
Apr 09, 2024 |
|
|
215490 |
FUW-hSNCA(D2R)-GFP |
alpha-synuclein (Homo sapiens)
|
Shalem |
Apr 09, 2024 |
|
|
215100 |
FokI(inactive)-mCherry-LacI-NLS |
FokI(inactive)-mCherry-LacI-NLS (Synthetic)
|
Pagano |
Apr 09, 2024 |
|
|
215102 |
KillerRed-LacI-NLS |
KillerRed-LacI-NLS (Synthetic)
|
Pagano |
Apr 09, 2024 |
|
|
217391 |
pCA3 |
cI78EP8 (Synthetic)
|
Vecchiarelli |
Apr 09, 2024 |
|
|
215096 |
FokI-mCherry-LacI-NLS |
FokI-mCherry-LacI-NLS (Synthetic)
|
Pagano |
Apr 09, 2024 |
|
|
217383 |
pYH75 |
PopTag (Synthetic)
|
Vecchiarelli |
Apr 09, 2024 |
|
|
217390 |
pYH89 |
mcdBsol (Synthetic)
|
Vecchiarelli |
Apr 09, 2024 |
|
|
215068 |
mVenus-Cyclin D1-NeoR |
CCND1 (Homo sapiens)
|
Pagano |
Apr 09, 2024 |
|
|
217384 |
pYH76 |
PopTag (Synthetic)
|
Vecchiarelli |
Apr 09, 2024 |