Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
215120 AcGFP-MLH1 MLH1 (Homo sapiens) Pagano Apr 10, 2024
215115 SS-Cyclin D2 CCND2 (Homo sapiens) Pagano Apr 10, 2024
215052 EGFP-Cyclin D3 CCND3 (Homo sapiens) Pagano Apr 10, 2024
213111 pkk223_Null No insert Horvath Apr 09, 2024
213110 pkk223_EcMutY MutY (adenine glycosylase) (Other) Horvath Apr 09, 2024
214767 pMSCV-IRES-GFP/CREB3L1 CREB3L1 (Homo sapiens) Komatsu Apr 09, 2024
214768 pMSCV-IRES-mOrange/CALR del52 human CALR del52 (Homo sapiens) Komatsu Apr 09, 2024
214769 pMSCV-IRES-mOrange/CALR ins5 human CALR ins5 (Homo sapiens) Komatsu Apr 09, 2024
214807 pMSCV-IRES-mOrange Komatsu Apr 09, 2024
214356 pAAV-SlugABE-NNG SlugABE-NNG (Synthetic) Wang Apr 09, 2024
212613 Noodles Plasmid Vinnikov Apr 09, 2024
217342 gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1) crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert Apr 09, 2024
214990 mNeonGreen-P2A-3xFLAG-msEEA1 HDR template EEA1 (Mus musculus) Harper Apr 09, 2024
214209 pDSG467 AraC, trpC Alon Apr 09, 2024
214983 pLV UBC APEX2-3xFLAG-IRES-eGFP APEX2 (Other) Harper Apr 09, 2024
214998 hTMEM115-TEV-3xHA-P2A-mScarlet HDR template hTMEM115-TEV-3xHA-P2A-mScarlet HDR template (Homo sapiens) Harper Apr 09, 2024
213927 LV2btCRISPRko.v1 na Tan Apr 09, 2024
213928 PBbtCRISPRko.v1 na Tan Apr 09, 2024
214999 hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template (Homo sapiens) Harper Apr 09, 2024
215000 pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template (Mus musculus) Harper Apr 09, 2024
217376 Lenti-mApple-6xHp mApple-6x Hp NC (Homo sapiens) Chang Apr 09, 2024
212694 pCfB10769 gRNA targeting to the intergradtion site E2 (Other) Borodina Apr 09, 2024
216503 pcDNA3 Ras-LOCKR-PL Key Ras-LOCKR-PL Key (Homo sapiens) Baker Apr 09, 2024
216502 pcDNA3 Ras-LOCKR-PL Cage Ras-LOCKR-PL Cage (Homo sapiens) Baker Apr 09, 2024
216497 pcDNA3 Ras-LOCKR-S R89L (negative control) Ras-LOCKR-S R89L negative control (Homo sapiens) Baker Apr 09, 2024
216496 pcDNA3 Ras-LOCKR-S Ras-LOCKR-S (Homo sapiens) Baker Apr 09, 2024
214467 pHelper_TS_V2_ampR CspRecT / Bxb-1 (Synthetic) Saunders Apr 09, 2024
213903 pDonor_Tn[GFP] mariner transposon with kan resistance and mNeonGreen (Synthetic) Collins Apr 09, 2024
140576 CaV1.2/pcDNA3.1~ Human human CaV1.2 (Homo sapiens) Minor Apr 09, 2024
211537 pLenti-GFP-2A-Puro-gATRIP_A sgRNA ATRIP (Synthetic) Sfeir Apr 09, 2024
208322 pET28b-PunyEEER PunyERRE (Synthetic) Beatty Apr 09, 2024
217381 pYH71 mcdB (Synthetic) Vecchiarelli Apr 09, 2024
217618 Human FLAG-WDR20 WDR20 (Homo sapiens) Lee Apr 09, 2024
217628 MBP-C5E-6XTUBE 6XTUBE (Other) Lee Apr 09, 2024
213721 psgRNA-GST-EGFP-GPICEAM7 EGFP (Homo sapiens) Huang Apr 09, 2024
215137 mCherry-PNKP PNKP (Homo sapiens) Pagano Apr 09, 2024
215148 pTRIPZ-FFSS-Cyclin D1 CCND1 (Homo sapiens) Pagano Apr 09, 2024
215486 FUW-hSNCA-NE alpha-synuclein (Homo sapiens) Shalem Apr 09, 2024
215487 FUW-hSNCA(D2R)-NE alpha-synuclein (Homo sapiens) Shalem Apr 09, 2024
215488 FUW-hSNCA(D2E)-NE alpha-synuclein (Homo sapiens) Shalem Apr 09, 2024
215489 FUW-hSNCA-GFP alpha-synuclein (Homo sapiens) Shalem Apr 09, 2024
215490 FUW-hSNCA(D2R)-GFP alpha-synuclein (Homo sapiens) Shalem Apr 09, 2024
215491 FUW-hSNCA(D2E)-GFP alpha-synuclein (Homo sapiens) Shalem Apr 09, 2024
215100 FokI(inactive)-mCherry-LacI-NLS FokI(inactive)-mCherry-LacI-NLS (Synthetic) Pagano Apr 09, 2024
215102 KillerRed-LacI-NLS KillerRed-LacI-NLS (Synthetic) Pagano Apr 09, 2024
217391 pCA3 cI78EP8 (Synthetic) Vecchiarelli Apr 09, 2024
215096 FokI-mCherry-LacI-NLS FokI-mCherry-LacI-NLS (Synthetic) Pagano Apr 09, 2024
217383 pYH75 PopTag (Synthetic) Vecchiarelli Apr 09, 2024
217390 pYH89 mcdBsol (Synthetic) Vecchiarelli Apr 09, 2024
215068 mVenus-Cyclin D1-NeoR CCND1 (Homo sapiens) Pagano Apr 09, 2024