Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
134323 3xFLAG-dCas9/pMSCVhyg 3xFLAG-dCas9 (Synthetic) Fujii Apr 22, 2024
204787 Sars Cov 2 Mac domain Sars Cov 2 Mac Domain (Other) von Delft Apr 22, 2024
217833 p4A8_M59I_T94M_BC 4A8 variant Fab (Homo sapiens) Whitehead Apr 22, 2024
217831 pYSD_lambda_mRFP Whitehead Apr 22, 2024
217830 pYSD_kappa_mRFP Whitehead Apr 22, 2024
217829 pMMP_lambda Whitehead Apr 22, 2024
216470 p2701-AGER-tdTomato tdTomato (Other) Kotton Apr 22, 2024
216471 p2702-AGER-gRNA1 sgRNA targeting human AGER locus (Homo sapiens) Kotton Apr 22, 2024
216472 p2703-AGER-gRNA2 sgRNA targeting human AGER locus (Homo sapiens) Kotton Apr 22, 2024
216473 p2704-AGER-gRNA3 sgRNA targeting human AGER locus (Homo sapiens) Kotton Apr 22, 2024
216474 p2705-AGER-eGFP eGFP (Other) Kotton Apr 22, 2024
216475 p2706-pHAGE-EF1aL-YAP5SA-UBC-GFP YAP5SA (Homo sapiens), eGFP (Other) Kotton Apr 22, 2024
216476 p2707-pHAGE-Ef1aL-dsRed-UBC-tagBFP dsRed (Other), tagBFP (Synthetic) Kotton Apr 22, 2024
216477 p2708-pHAGE2-Ef1aL-dsRed-UBC-tagBFP-loxP dsRed (Other), tagBFP (Synthetic) Kotton Apr 22, 2024
216478 p2709-pHAGE2-Ef1aL-YAP5SA-UBC-tagBFP-loxP YAP5SA (Homo sapiens), tagBFP (Synthetic) Kotton Apr 22, 2024
216479 p2710-pHAGE2-Ef1aL-wtYAP-UBC-tagBFP-loxP wtYAP (YAP1) (Homo sapiens), tagBFP (Synthetic) Kotton Apr 22, 2024
216480 p2711-pHAGE2-Ef1aL-TAZ4SA-UBC-tagBFP-loxP TAZ4SA (Homo sapiens), tagBFP (Synthetic) Kotton Apr 22, 2024
217828 pMMP_kappa Whitehead Apr 22, 2024
217827 pBDP Gal1/Gal10 Bidirectional Promoter (Saccharomyces cerevisiae) Whitehead Apr 22, 2024
210548 pCLV3Cas-LT0 CLV3p::spCas9::PEA3At::U6p::AAVS1gRNA::pHTR5::LT0::mCherrySSM (Other) Mittelsten Scheid Apr 22, 2024
217480 FCK-CaMKII-Solaris-WPRE Solaris (Synthetic) Zou Apr 22, 2024
217478 pcDNA3.1-CMV-Nier1s-3NLS-P2A-EGFP-3NLS Nier1s (Synthetic) Zou Apr 22, 2024
217479 pcDNA3.1-CMV-Nier1b-3NLS-P2A-EGFP-3NLS Nier1b (Synthetic) Zou Apr 22, 2024
216207 pBM-strep-UCP1 UCP1 (Homo sapiens) Chen Apr 22, 2024
217819 pACYCDUET-StrepSUMO-DaPFOR pACYCDUET-StrepSUMO-DaPFOR (Other) Silver Apr 22, 2024
217824 pET28a-CdRdhA N-His-CdRhdA (Other) Silver Apr 22, 2024
217822 pCDB179-RdhC1 RdhC1 (Other) Silver Apr 22, 2024
217823 pCDB179-RdhF3 RdhF3 (Other) Silver Apr 22, 2024
217821 pET28a-DhFld DhFld (Other) Silver Apr 22, 2024
217976 pAAV-hSyn-FLEX-H2BmTagBFP2-oG H2BmTagBFP2 (Synthetic), oG (Synthetic) Callaway Apr 22, 2024
217977 pAAV-nef-AO-66-71-TVA950 TVA950 Callaway Apr 22, 2024
217979 pSAD-5PSD95-EGFP-SynPhRFP 5PSD95-EGFP (Rattus norvegicus), SynPhRFP (Mus musculus) Callaway Apr 22, 2024
217975 pAAV-EF1a-fDIO-stGtACR2-FusionRed stGtACR2-FusionRed (Synthetic) Callaway Apr 22, 2024
205159 pcDNA-tdMCP-6xGCN4 tdMCP-6xGCN4 (Synthetic) Ma Apr 22, 2024
205157 pcDNA-tdMCP-24xGCN4 tdMCP-24xGCN4 (Synthetic) Ma Apr 22, 2024
207608 3xMS2 TR knockin sgRNA 2 acccccaaacctgactgact (Homo sapiens) Schmidt Apr 22, 2024
207561 ULK1 KO sgRNA CCCGCCTGCGCCATGGAGCC (Homo sapiens) Schmidt Apr 22, 2024
207558 ATG13 sgRNA ggaaactgatctcaattccc (Homo sapiens) Schmidt Apr 22, 2024
207542 Halo-ATG5 HRD HaloTag flanked by human ATG5 locus sequences (Homo sapiens) Schmidt Apr 22, 2024
207579 TR knockout HRD puro resistance cassette flanked by TR locus sequences excluding TR (Homo sapiens) Schmidt Apr 22, 2024
207578 3xFLAG-Halo-Dyskerin HaloTag DKC1 (Homo sapiens) Schmidt Apr 22, 2024
207548 ULK1-Halo HRD HaloTag followed by a PolyA signal and PuroR cassette flanked by human ULK1 locus sequences (Homo sapiens) Schmidt Apr 22, 2024
197864 pCMV_PACLight1 PACLight1 (Homo sapiens) Patriarchi Apr 22, 2024
205149 Lenti-DAG1 Dystroglycan 1 (Homo sapiens) Lek Apr 19, 2024
205150 Lenti-UbC-FKRP-EF1a-BSD Fukutin-related protein (Homo sapiens) Lek Apr 19, 2024
205151 Lenti-UbC-LARGE1-EF1a-BSD LARGE xylosyl- and glucuronyltransferase 1 (Homo sapiens) Lek Apr 19, 2024
211336 m.3047-Left TALE-G1397-N-DddA11-mCherry m.3047-Left TALE-G1397-N-DddA11-mCherry Lek Apr 19, 2024
211337 m.3075-Left TALE-G1397-N-DddA11-mCherry m.3075-Left TALE-G1397-N-DddA11-mCherry Lek Apr 19, 2024
211338 m.5147-Left TALE-G1397-N-DddA11-mCherry m.5147-Left TALE-G1397-N-DddA11-mCherry Lek Apr 19, 2024
211339 m.3047-Left TALE-G1397-N-dead-mCherry m.3047-Left TALE-G1397-N-dead-mCherry (Homo sapiens) Lek Apr 19, 2024