Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
218658 PLEKHA8 (FAPP2) g1 lentiCRISPRv2-opti PLEKHA8 (Homo sapiens) Harper May 01, 2024
215309 pMVV103 sfGFP (Synthetic) Pfleger May 01, 2024
215341 pMVV111 sfGFP (Synthetic) Pfleger May 01, 2024
215295 pWN212 sfGFP (Synthetic) Pfleger May 01, 2024
215312 pMVV106 sfGFP (Synthetic) Pfleger May 01, 2024
218635 pLV UBC msNLRP3(LRRm2)-APEX2-3xFLAG-IRES-eGFP (N1008R_R1009E_E1010R_R1013E) NLRP3 (Mus musculus) Harper May 01, 2024
215283 pWN164 sfGFP (Synthetic) Pfleger May 01, 2024
215310 pMVV104 sfGFP (Synthetic) Pfleger May 01, 2024
218656 PLEKHA3 (FAPP1) g1 lentiCRISPRv2-opti PLEKHA3 (Homo sapiens) Harper May 01, 2024
215650 pACYC-pVhb-vfFadBA thiolase (FadA), β-hydroxy-acyl-CoA reductase (FadB) (Other) Pfleger May 01, 2024
218637 pLV UBC OSBP(PH)-APEX2-3xFLAG-IRES-eGFP OSBP (Homo sapiens) Harper May 01, 2024
218663 GOLIM4 g2 LentiCRISPRv2-mCherry GOLIM4 (Homo sapiens) Harper May 01, 2024
218634 pLV UBC msNLRP3(ΔPYD, I125M-END)-APEX2-3xFLAG-IRES-eGFP NLRP3 (Mus musculus) Harper May 01, 2024
213670-rAb Anti-Integrin alpha 4 [IPI-9C10] (Recombinant Antibody) (IPI) May 01, 2024
218660 TMEM165 g1 LentiCRISPRv2-mCherry TMEM165 (Homo sapiens) Harper May 01, 2024
218653 msHook2 g2 lentiCRISPRv2-mCherry Hook2 (Mus musculus) Harper May 01, 2024
218662 GOLIM4 g1 LentiCRISPRv2-mCherry GOLIM4 (Homo sapiens) Harper May 01, 2024
213505 pJG01 TdTomato (Synthetic) Gerdt May 01, 2024
210165 pRH3128 YIp ADE2-LEU2 pTDH3::ADE1-GFP::tADH1 (Saccharomyces cerevisiae) Hampton May 01, 2024
217966 pCL1333 RAN (Homo sapiens) Bowman May 01, 2024
210143 pRH2941 YIp ADE2-LEU2 pTDH3::ARO7-GFP::tADH1 (Saccharomyces cerevisiae) Hampton May 01, 2024
205998 pMVS1111A:PhmtB-bgaB thermostable beta-galactosidase Molitor May 01, 2024
218828 pBEVY-4420-mCherry 4-4-20 scFv (Mus musculus) Cho May 01, 2024
218827 pBEVY-pT231 scFv-GFP pT231 tau scFv (Gallus gallus) Cho May 01, 2024
213361 OPRM1-DuET OPRM1 (Homo sapiens) Sakmar Apr 30, 2024
213347 MRGPRX4-DuET MRGPRX4 (Homo sapiens) Sakmar Apr 30, 2024
213345 MRGPRX2-DuET MRGPRX2 (Homo sapiens) Sakmar Apr 30, 2024
213334 LTB4R2B-DuET LTB4R2B (Homo sapiens) Sakmar Apr 30, 2024
213333 LTB4R-DuET LTB4R (Homo sapiens) Sakmar Apr 30, 2024
213332 LPAR6-DuET LPAR6 (Homo sapiens) Sakmar Apr 30, 2024
213326 HTR6-DuET HTR6 (Homo sapiens) Sakmar Apr 30, 2024
213324 HTR4-DuET HTR4 (Homo sapiens) Sakmar Apr 30, 2024
213320 HTR1F-DuET HTR1F (Homo sapiens) Sakmar Apr 30, 2024
213303 GRM5-DuET GRM5 (Homo sapiens) Sakmar Apr 30, 2024
213302 GRM4-DuET GRM4 (Homo sapiens) Sakmar Apr 30, 2024
213284 GPR45-DuET GPR45 (Homo sapiens) Sakmar Apr 30, 2024
213267 GPR156-DuET GPR156 (Homo sapiens) Sakmar Apr 30, 2024
213246 TH1534-DuET TH1534 (Homo sapiens) Sakmar Apr 30, 2024
213245 TH1533-DuET TH1533 (Homo sapiens) Sakmar Apr 30, 2024
213244 TH1532-DuET TH1532 (Homo sapiens) Sakmar Apr 30, 2024
213243 TH1531-DuET TH1531 (Homo sapiens) Sakmar Apr 30, 2024
213227 DRD1-DuET DRD1 (Homo sapiens) Sakmar Apr 30, 2024
218196 pET-29b(+)_His-CBD-SpEndoH EndoH (Other) Pojer Apr 30, 2024
218193 pET-29b(+)_His-CBD-3C-EmPNGaseF PNGaseF (Other) Pojer Apr 30, 2024
218194 pET-29b(+)_His-CBD-EmEndoF3 EndoF3 (Other) Pojer Apr 30, 2024
218198 pET-29b(+)_notufA-CmEndoCOM_3C-CBD-His EndoCOM (Other) Pojer Apr 30, 2024
218197 pET-29b(+)_notufA-EmEndoF2-CBD-His EndoF2 (Other) Pojer Apr 30, 2024
218195 pET-29b(+)_His-CBD-EmEndoF1 EndoF1 (Other) Pojer Apr 30, 2024
207078 Halo-SHLD2 HRD HaloTag with internal PuroR cassette flanked by human SHLD2 locus sequences (Homo sapiens) Schmidt Apr 30, 2024
207089 ATM N-terminal sgRNA ATCATTAAGTACTAGACTCA (Homo sapiens) Schmidt Apr 30, 2024