Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
184811 pDestTol2-QUAS:GFP QUAS:GFP-pA Halpern May 29, 2024
184812 pDestTol2-QUAS:mApple-he1.1:CFP QUAS:mApple-pA; he1.1:CFP Halpern May 29, 2024
184813 pDestTol2-QUAS:GFP-CAAX QUAS:GFP-CAAX-pA Halpern May 29, 2024
184814 pDestTol2-QUAS:NLS-mApple-he1.1:CFP QUAS:NLS-mApple-pA; he1.1:CFP Halpern May 29, 2024
184815 pDestTol2-QUAS:NLS-GFP-he1.1:CFP QUAS:NLS-GFP-pA; he1.1:CFP Halpern May 29, 2024
218156 pSCBE3-HF1 scbe3-HF1 (Other), a programmable sgRNA cloning cassette (Synthetic) Sun May 29, 2024
209783 AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-miR122 TS miR122 ts (Synthetic) Guo May 29, 2024
209784 pAAV-cTNT-Cre-miR122 TS miR122 ts (Synthetic) Guo May 29, 2024
209785 AAV-cTNT-Cre Cre (Synthetic) Guo May 29, 2024
209786 pAAV-TNT4-TadA8e-SpRY N aa2-713-InteinN TNT4, TadA8e, SpRY N, inteinN (Synthetic) Guo May 29, 2024
209787 pAAV-TNT4-TadA8e-SpRY N aa2-713-InteinN-miR122 TS TNT4, TadA8e, SpRY N, inteinN, miR122 TS (Synthetic) Guo May 29, 2024
209788 pAAV-CASI-InteinC-SpRY C aa714-1368-U6-Camk2d sgRNA SpRY C, Camk2d sgRNA (Synthetic) Guo May 29, 2024
209781 AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS cTNT (Synthetic) Guo May 29, 2024
209782 AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS sgRNA (Synthetic) Guo May 29, 2024
217672 PE-SUMO CRYGA CRYGA (Homo sapiens) David May 28, 2024
217670 PE-SUMO CRYAB CRYAB (Homo sapiens) David May 28, 2024
217675 PE-SUMO CRYBB1 CRYBB1 (Homo sapiens) David May 28, 2024
218665 pJK2097 fbf-2 (Caenorhabditis elegans) Kimble May 28, 2024
99693 pAAV-CMV-dSa VP64 Hbb dCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Mus musculus) Church May 28, 2024
99668 dSp-Rta 125-175 dCas9 (Synthetic) Church May 28, 2024
99669 dSp-VP64-RTA(75-190) dCas9 (Synthetic) Church May 28, 2024
99660 dSp-p65 (1-100) dCas9 (Synthetic) Church May 28, 2024
99661 dSp-p65 (50-150) dCas9 (Synthetic) Church May 28, 2024
99662 dSp-Rta Full (1-190) dCas9 (Synthetic) Church May 28, 2024
99663 dSp-Rta 75-190 dCas9 (Synthetic) Church May 28, 2024
99666 dSp-Rta 75-175 dCas9 (Synthetic) Church May 28, 2024
99654 dSp-p65 Full (1-261) dCas9 (Synthetic) Church May 28, 2024
99655 dSp-p65 (150-261) dCas9 (Synthetic) Church May 28, 2024
99656 dSp-p65 (100-261) dCas9 (Synthetic) Church May 28, 2024
99657 dSp-p65 (200-261) dCas9 (Synthetic) Church May 28, 2024
99658 dSp-p65 (1-200) dCas9 (Synthetic) Church May 28, 2024
99659 dSp-p65 (1-150) dCas9 (Synthetic) Church May 28, 2024
216417 pC1-oROS-HT-CaaX oROS-HT-CaaX (Other) Berndt May 28, 2024
216420 pC1-lifeact-oROS-HT lifeact-oROS-HT (Other) Berndt May 28, 2024
216112 pC3.1_CMV_oROS-G_LF(C199S) oROS-G_LF(C199S) (Other) Berndt May 28, 2024
216111 pC3.1_CMV_oROS-G oROS-G (Other) Berndt May 28, 2024
219654 pAAV Syn 2xLyn-ERex-mKate2-bPAC(F198Y) 2xLyn-ERex-mKate2-bPAC(F198Y) (Homo sapiens) Oertner May 28, 2024
219653 pAAV nEF 2xLyn-ERex-Venus(Y145W)-bPAC(F198Y) 2xLyn-ERex-Venus(Y145W)-bPAC(F198Y) (Homo sapiens) Oertner May 28, 2024
216236 pCD510B attp BSD blasticidin S deaminase (Other) Ro May 28, 2024
216237 pCS2+ phiC31 integrase integrase from phage φC31 (Other) Ro May 28, 2024
216238 pSIQ Ro May 28, 2024
216239 pSIQ-EGFP EGFP (Other) Ro May 28, 2024
216240 pSIQmate Ro May 28, 2024
216241 pSIQmate-EGFP EGFP (Other) Ro May 28, 2024
208746 CEL-IFP2-SOScat CEL-IFP2-SOScat (Homo sapiens) Shu May 28, 2024
205591 pGEL682 Zhang May 28, 2024
205592 pGEL685 Zhang May 28, 2024
205593 pGEL683 Zhang May 28, 2024
207510 pGEL686 zCas9 (H840A)-NC-M-MLV RT-deltaRH (Synthetic) Zhang May 28, 2024
216276 pAAV-hSyn-DIO-NES-jRGECO1a-WPRE NES-jRGECO1a Cui May 28, 2024