Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
143756 TFORF1079 NFATC4 (Homo sapiens) Zhang May 01, 2025
143737 TFORF0908 BCLAF1 (Homo sapiens) Zhang May 01, 2025
143734 TFORF0877 GLMP (Homo sapiens) Zhang May 01, 2025
143733 TFORF0865 GTF2I (Homo sapiens) Zhang May 01, 2025
143731 TFORF0853 ZIC5 (Homo sapiens) Zhang May 01, 2025
143730 TFORF0781 ZNF93 (Homo sapiens) Zhang May 01, 2025
143728 TFORF0729 ZNF518B (Homo sapiens) Zhang May 01, 2025
143727 TFORF0705 NCOR1 (Homo sapiens) Zhang May 01, 2025
143717 TFORF0602 ZNF728 (Homo sapiens) Zhang May 01, 2025
143712 TFORF0561 ZNF616 (Homo sapiens) Zhang May 01, 2025
143701 TFORF0444 ZFX (Homo sapiens) Zhang May 01, 2025
142693 TFORF0808 SMARCC1 (Homo sapiens) Zhang May 01, 2025
142679 TFORF0716 ZNF621 (Homo sapiens) Zhang May 01, 2025
142678 TFORF0711 ZNF625 (Homo sapiens) Zhang May 01, 2025
142676 TFORF0690 HNF4G (Homo sapiens) Zhang May 01, 2025
237517 pUC19::ZmUBI-VirPWT4 VirPwt4 (Other) Coaker May 01, 2025
237525 pGADT7-RWT4Ca_Reg1 Rwt4Ca_Reg1 (Other) Coaker May 01, 2025
237509 pUC19::ZmUBI-RWT4Ca Rwt4Ca (Other) Coaker May 01, 2025
236749 pCMV-BirA-HA-Tulp3 Tulp3 (Mus musculus) Zhang May 01, 2025
237526 pGADT7-RWT4Ca+C-Tail Rwt4Ca+C-Tail (Other) Coaker May 01, 2025
237522 pET28a:GST-AvrPWT4 AvrPwt4 (Other) Coaker May 01, 2025
237521 pET28a:His-MBP-PKD Rwt4_pseudokinase (Other) Coaker May 01, 2025
237510 pUC19::ZmUBI-RWT4Cs Rwt4Cs (Other) Coaker May 01, 2025
237534 pTA7001-RWT4Ca_KDup Rwt4Ca_Dup (Other) Coaker May 01, 2025
237524 pGADT7-RWT4Ca Rwt4Ca (Other) Coaker May 01, 2025
237520 pET28a:His-MBP-KD Rwt4_kinase (Other) Coaker May 01, 2025
237519 pET28a:His-RWT4Ca Rwt4Ca (Other) Coaker May 01, 2025
237523 pET28a:GST-VirPWT4 VirPwt4 (Other) Coaker May 01, 2025
237518 pET28a:His-MBP-RWT4Ca Rwt4Ca (Other) Coaker May 01, 2025
237512 pUC19::ZmUBI-RWT4Ca_Reg1 Rwt4Ca_Reg1 (Other) Coaker May 01, 2025
237535 pET28a:His-MBP-RWT4Ca_noKDup Rwt4Ca_noKDup (Other) Coaker May 01, 2025
237527 pGBKT7-AvrPWT4 AvrPwt4 (Other) Coaker May 01, 2025
237528 pGBKT7-VirPWT4 VirPwt4 (Other) Coaker May 01, 2025
236521 Strep-His-Tev-GFP-hCGNL1 CGNL1 (Homo sapiens) Citi May 01, 2025
236520 Strep-His-Tev-hCGNL1 CGNL1 (Homo sapiens) Citi May 01, 2025
233200 pMXs-HRAS(G12V)-IRES-SNAP-p53DD HRAS(G12V)-IRES-SNAP-p53DD (Homo sapiens) Galloway May 01, 2025
236527 Strep-Tev-Avi-hZO-1 TJP1 (Homo sapiens) Citi May 01, 2025
236512 Strep-His-Tev-hCGN CGN (Homo sapiens) Citi May 01, 2025
236234 pAAV hSyn INTRON mEmerald-STIM1 WPRE mEmerald-Stim1 (Mus musculus) Lippincott-Schwartz May 01, 2025
236238 pAAV hSyn INTRON HaloTag-Jph3 WPRE Junctophilin 3 (Homo sapiens) Lippincott-Schwartz May 01, 2025
236235 pAAV hSyn INTRON HaloTag-STIM2 WPRE HaloTag-STIM2 (Homo sapiens) Lippincott-Schwartz May 01, 2025
236043 pQdCas12a.luxR(mut)-sggfp(C) quorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene Mahadevan May 01, 2025
236246 pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2 gRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2 (Synthetic) Lippincott-Schwartz May 01, 2025
236232 pAAV hSyn INTRON mScarlet-CAAX2 WPRE mScarletI fused to the plasma membrane targeting sequence CAAX2 (Synthetic) Lippincott-Schwartz May 01, 2025
233161 pMXs-mNgn2x3HA-T2A-Isl1 mNgn2x3HA-T2A-Isl1 (Mus musculus) Galloway May 01, 2025
232310 hETFDH CRISPR_2 ETFDH-targeting gRNA (Homo sapiens) Topisirovic May 01, 2025
236567 pcDNA3.1(+)-FLAG-RGS14 Homo sapiens regulator of G-protein signaling 14 (Homo sapiens) Hepler May 01, 2025
207537 Halo-ATG16L1 HRD HaloTag with internal PuroR cassette flanked by human ATG16L1 locus sequences (Homo sapiens) Schmidt May 01, 2025
207100 RNF168 C-terminal sgRNA GAGATGCACAAAGTAAGGCC (Homo sapiens) Schmidt May 01, 2025
207096 RIF C-terminal sgRNA AATACTAAATAGAATTTTCA (Homo sapiens) Schmidt May 01, 2025