Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
193070 pFUW-tetO-mCh-Gata2-del-NLS(380-440) mCh-Gata2-del-NSL(380-440) (Mus musculus) Pereira Aug 07, 2023
193071 SFFV-mCh-GATA2 mCh-GATA2 (Homo sapiens) Pereira Aug 07, 2023
193072 SFFV-mCh-GATA2-R293Q mCh-GATA2-R293Q (Homo sapiens) Pereira Aug 07, 2023
193073 SFFV-mCh-GATA2-P304H mCh-GATA2-P304H (Homo sapiens) Pereira Aug 07, 2023
193074 SFFV-mCh-GATA2-R307W mCh-GATA2-R307W (Homo sapiens) Pereira Aug 07, 2023
193075 SFFV-mCh-GATA2-A318T mCh-GATA2-A318T (Homo sapiens) Pereira Aug 07, 2023
193076 SFFV-mCh-GATA2-L321F mCh-GATA2-L321F (Homo sapiens) Pereira Aug 07, 2023
193077 SFFV-mCh-GATA2-R330Q mCh-GATA2-R330Q (Homo sapiens) Pereira Aug 07, 2023
193078 SFFV-mCh-GATA2-T354M mCh-GATA2-T354M (Homo sapiens) Pereira Aug 07, 2023
193079 SFFV-mCh-GATA2-L359V mCh-GATA2-L359V (Homo sapiens) Pereira Aug 07, 2023
193080 SFFV-mCh-GATA2-R361L mCh-GATA2-R361L (Homo sapiens) Pereira Aug 07, 2023
193081 SFFV-mCh-GATA2-R362Q mCh-GATA2-R362Q (Homo sapiens) Pereira Aug 07, 2023
193082 SFFV-mCh-GATA2-C373R mCh-GATA2-C373R (Homo sapiens) Pereira Aug 07, 2023
193083 SFFV-mCh-GATA2-R396Q mCh-GATA2-R396Q (Homo sapiens) Pereira Aug 07, 2023
193060 pFUW-tetO-mCherry mCherry Pereira Aug 07, 2023
193061 pFUW-tetO-mCh-Gata2 mCh-Gata2 (Mus musculus) Pereira Aug 07, 2023
193062 pFUW-tetO-mCh-Gfi1b mCh-Gfi1b (Mus musculus) Pereira Aug 07, 2023
193063 pFUW-teto-mch-cFos mch-cFos (Mus musculus) Pereira Aug 07, 2023
193064 pHAGE-Gata2-mCh Gata2-mCh (Mus musculus) Pereira Aug 07, 2023
193065 pHAGE-Gfi1b-mCh Gfi1b-mCh (Mus musculus) Pereira Aug 07, 2023
193066 pHAGE-cFos-mCh cfos-mCh (Mus musculus) Pereira Aug 07, 2023
193067 pFUW-tetO-mCh-Gata2-del-N-Terminal(1-235) mCh-Gata2-del-N-Terminal(1-235) (Mus musculus) Pereira Aug 07, 2023
197854 pJMC-5-Empty Voytas Aug 07, 2023
204722 iE61 PB-Zim3-XTEN-dCas9-mScarlet-puro-BFP Zim3-dCas9 (Synthetic) Ward Aug 07, 2023
191655 pCRISPomyces-AsCas12j-2 AsCas12j-2 (Other) Wong Aug 07, 2023
204725 iF51 PB-Zim3-dCas9-mScarlet-Hygro-Neo-SnapTag Zim3-dCas9 (Synthetic) Ward Aug 07, 2023
201131 plex_307-EYFP-ccdB-blasticidin Chavez Aug 07, 2023
201129 plex_307-EYFP-ccdB-zeo Chavez Aug 07, 2023
201128 plex_307-EYFP-ccdB-g418 Chavez Aug 07, 2023
161664 IDG_CLCN6_OE_1 CLCN6 (Homo sapiens) McManus Aug 05, 2023
195570 pTet-Bxb1-Xis-mScarlet Bxb1 Excisionase Fused With mScarlet (Synthetic) Murray Aug 04, 2023
202070 pGEX-2T_E30_VP1 E30 VP1 protein with Histag (Synthetic) Hytönen Aug 04, 2023
204720 iD20 LoxStopLox-Zim3-dCas9-mApple-hygro Zim3-dCas9 (Synthetic) Ward Aug 04, 2023
201917 pJRH-1346 U6-B2M sgRNA Gag-pol v2 Gag-pol, B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA) Doudna Aug 04, 2023
201913 pJRH-1187 VSVGmut VSV-G (K47Q, R354A) (Other) Doudna Aug 04, 2023
201914 pJRH-1179 U6-reci Gag-Cas9 v2 Gag-Cas9 v2 Doudna Aug 04, 2023
204719 iC10 PB-zim3-mycNLS-mApple-hygro Zim3-dCas9 (Synthetic) Ward Aug 04, 2023
201915 pJRH-1180 U6-reci Gag-pol v2 Gag-pol Doudna Aug 04, 2023
201912 pJRH-1362 scFv entry plasmid Stuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain Doudna Aug 04, 2023
204718 iB22 PB-zim3-mycNLS-mApple Zim3-dCas9 (Synthetic) Ward Aug 04, 2023
201916 pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2 Gag-Cas9 v2, B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA) Doudna Aug 04, 2023
198948 pGL0_35 [aadA] aadA (Other) Ostrov Aug 04, 2023
198975 pGL0_64 [mScarlet] mScarlet-I (Synthetic) Ostrov Aug 04, 2023
202069 pGEX-2T_CVB1_VP1 CVB1 VP1 protein with Histag (Synthetic) Hytönen Aug 04, 2023
202068 pGEX-2T_CVA4_VP1 CVA4 VP1 protein with Histag (Synthetic) Hytönen Aug 04, 2023
199118 pKI1 H6-SNAP-RapA (Other) Gelles Aug 04, 2023
199119 pDT2 lambda PR' - repeat cassette - E. coli rpoB - lambda TR' (Synthetic) Gelles Aug 04, 2023
199120 pDT4 synthetic transcription template Gelles Aug 04, 2023
195578 pCMV_NOPlight1 NOPLight1 (Homo sapiens) Patriarchi Aug 04, 2023
195579 pCMV_NOPLight-ctr NOPLight-ctr (Homo sapiens) Patriarchi Aug 04, 2023