Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
113735 pENTR-PpU6P-sgRNA-L1L2 PpU6P::sgRNA (Other) Bezanilla Sep 24, 2018
114000 pOGG082 NifH promoter (Synthetic) Poole Sep 24, 2018
113990 pOGG016 Endlinker/terminator Part 6 (Synthetic) Poole Sep 24, 2018
61479 pEn-C1.1 AtU6-26:sgRNA (Arabidopsis thaliana) Puchta Sep 24, 2018
61478 pCAS9-TPC Cas9 (Arabidopsis thaliana) Puchta Sep 24, 2018
61477 pDe-CAS9-D10A Cas9-D10A (Arabidopsis thaliana) Puchta Sep 24, 2018
61476 pChimera U6-26:sgRNA (Arabidopsis thaliana) Puchta Sep 24, 2018
61433 pDe-CAS9 Cas9 (Arabidopsis thaliana) Puchta Sep 24, 2018
61432 pEn-Chimera AtU6-26:sgRNA (Arabidopsis thaliana) Puchta Sep 24, 2018
115651 pJH298 V(D)J recombination substrate Gellert Sep 24, 2018
115503 pOGG202 pL1M-F1-plac pOGG031, sfGFP pOGG037, T-pharma pOGG003 (Synthetic) Poole Sep 24, 2018
115650 Rag2 T490A Rag2 (Mus musculus) Gellert Sep 24, 2018
115649 R2Ct (1-520) Rag2 (1-520) (Mus musculus) Gellert Sep 24, 2018
115504 pOGG203 pL1M-F2-pNeo pOGG001, mCherry EC15071, T-pharma(pOGG003 (Synthetic) Poole Sep 24, 2018
115646 coreR1 (384-1008) Rag1 core (384-1008) (Mus musculus) Gellert Sep 24, 2018
112008 pAAV-hSynapsin1-FLEx-axon-GCaMP6s-P2A-mRuby3 axon-GCaMP6s-P2A-mRuby3 (Synthetic) Tian Sep 24, 2018
99695 pAAV-CMV-dSa VP64 Neurog2 dCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus) Church Sep 22, 2018
80591 TR-GFP GFP Asokan Sep 22, 2018
115365 phRL TK 5BoxB sp 36 Renilla Luciferase (Other) Filipowicz Sep 21, 2018
115360 pCIneo-HA HA (Other) Filipowicz Sep 21, 2018
115359 pCIneo-NHA N peptide and HA (Other) Filipowicz Sep 21, 2018
115362 pCIneo-HA-Ago2 Argonaute 2 (Homo sapiens) Filipowicz Sep 21, 2018
115361 pCIneo-NHA-Ago2 Argonaute 2 (Homo sapiens) Filipowicz Sep 21, 2018
115363 pCIneo-NHA-LacZ lacZ beta-D-galactosidase (Other) Filipowicz Sep 21, 2018
115366 p CIneo-RL Renilla Luciferase (Other) Filipowicz Sep 21, 2018
115364 pCIneo-RL-5BoxB Renilla Luciferase (Other) Filipowicz Sep 21, 2018
112915 pLX-sgRNA-BfuAI-2k Lin Sep 21, 2018
115368 p CIneo-RL-Let7-3xBulgeB Renilla Luciferase (Other) Filipowicz Sep 21, 2018
115367 p CIneo-RL-Let7-perf Renilla Luciferase (Other) Filipowicz Sep 21, 2018
113633 pCas-CmR(+) Chloramphenicol resistance gene (Other) Lichtarge Sep 21, 2018
112266 CMV-mEGFP-PKCg-C1 protein kinase c gamma (Mus musculus) Yasuda Sep 21, 2018
115648 coreR2 (1-387) Rag2 core (1-387) (Mus musculus) Gellert Sep 21, 2018
112267 CMV-mCh-kCAAX mCherry with KRas membrane targeting domain Yasuda Sep 21, 2018
108685 CAG-mCherry mCherry Green Sep 21, 2018
115693 pSTAR-mOrange2-sfGFP SA-mOrange2-sfGFP-SD (Synthetic) Suter Sep 21, 2018
114490 Anti-Kirrel3, short and long [N321C/49R] anti-Kirrel3, short and long (Rattus norvegicus) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 21, 2018
114683 pRC04 FRB-TEV-N Good Sep 21, 2018
114680 pRC01 sfGFP Strands 1-9 (Synthetic) Good Sep 21, 2018
114681 pRC02 sfGFP.Strand10-Haloenzyme (Synthetic) Good Sep 21, 2018
115268 pC0073 EiCsm6 His6-TwinStrep-SUMO-BsaI EiCsm6 (Other) Zhang Sep 21, 2018
115219 pC0068 PspCas13 (B12) His6-TwinStrep-SUMO-BsaI PspCas13 (Other) Zhang Sep 21, 2018
114488 Anti-Dopamine D3 receptor [N331/19R] anti-Dopamine D3 receptor (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 21, 2018
114487 Anti-Botch [N116/14R] anti-Botch (Rattus norvegicus) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 21, 2018
114485 Anti-NSD3 [N348/82R] anti-NSD3 (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 21, 2018
114484 Anti-Stonin-2 [N346/9R] anti-Stonin-2 (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 21, 2018
114483 Anti-GluA1/GluR1 glutamate receptor [N355/1R] anti-GluA1/GluR1 glutamate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 21, 2018
110621 pBTK621 GFP (Synthetic) Barrick Sep 21, 2018
114684 pRC05 FKBP-TEV-C Good Sep 21, 2018
114481 Anti-QKI-5 [N195A/16R] anti-QKI-5 (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 21, 2018
114479 Anti-Ankyrin-R [N388A/10R] anti-Ankyrin-R (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 21, 2018