Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
220834 pENN226_CRISPRcharm CRISPRcharm (Homo sapiens) Weissman Jun 25, 2024
221188 p2H12ref cdGreen (Synthetic), mScarlet-I (Synthetic) Jenal Jun 25, 2024
213495 pCDF-B-pC cinI, lacI, lambda cI, sfGFP Isalan Jun 25, 2024
221187 pET28-2H12Matry cdGreen-Matry (Synthetic) Jenal Jun 25, 2024
205144 pYPQ141B-ge4.1 gRNA cloning site Qi Jun 25, 2024
221186 pET28-2H12 cdGreen (Synthetic) Jenal Jun 25, 2024
221185 pBBR15.2-2H12.D11opt cdGreen2.1 (Synthetic) Jenal Jun 25, 2024
221184 pQFmcs-2H12.D11-scarREF cdGreen2 (Synthetic), mScarlet-I (Synthetic) Jenal Jun 25, 2024
221182 pConRef-2H12 cdGreen (Synthetic), mScarlet-I (Synthetic) Jenal Jun 25, 2024
221181 p2H12Matry-blind cdGreen-Matry(blind) (Synthetic) Jenal Jun 25, 2024
221151 pConRef-2H12.D11 cdGreen2 (Synthetic), mScarlet-I (Synthetic) Jenal Jun 25, 2024
221150 pBBR15.2-2H12.D11opt-scarRef cdGreen2.1 (Synthetic), mScarlet-I (Synthetic) Jenal Jun 25, 2024
221145 pET28-2H12.D11 cdGreen2 (Synthetic) Jenal Jun 25, 2024
204050 pTU2-a_Sv5KA_amilCP Shapiro Jun 25, 2024
221143 p2H12Matry cdGreen-Matry (Synthetic) Jenal Jun 25, 2024
221142 p2H12 cdGreen (Synthetic) Jenal Jun 25, 2024
214432 piggyBAC-BRD4-Flag Brd4 bromodomain containing 4 (Mus musculus) Cowley Jun 25, 2024
203917 pWR95(URA3) URA3 upstream homology (Other), URA3 downstream homology (Other) Robertson Jun 25, 2024
203915 pWR91 CRF1 plus flanking (Other) Robertson Jun 25, 2024
203914 pWR90 GSC2 plus flanking (Other) Robertson Jun 25, 2024
203423 pWR89 EGC3 plus flanking (Other) Robertson Jun 25, 2024
203422 pWR88 CAR copy 1 (Other), P(TEF1)/coKanMX/T(ACT1) + P(TDH3)/coCBG/T(ADH2) (Synthetic), CAR copy 2 (Other) Robertson Jun 25, 2024
203336 pWR63(YUM1) TEF1 promoter (S. stipitis) (Other), coHPH (Synthetic), ACT1 terminator (S. stipitis) (Other), CCW12 promoter (S. stipitis) (Other), CaCas9 (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other), THD3 promoter (S. stipitis) (Other), tRNA-sgRNA(SapI)-HDV (Synthetic), ADH1 terminator (S. stipitis) (Other), YUM1-targeting sequence (Synthetic) Robertson Jun 25, 2024
203331 pWR63 TEF1 promoter (S. stipitis) (Other), coHPH (Synthetic), ACT1 terminator (S. stipitis) (Other), CCW12 promoter (S. stipitis) (Other), CaCas9 (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other), THD3 promoter (S. stipitis) (Other), tRNA-sgRNA(SapI)-HDV (Synthetic), ADH1 terminator (S. stipitis) (Other) Robertson Jun 25, 2024
202776 pWR76 TEF1 promoter (S. stipitis) (Other), coHPH (Synthetic), ACT1 terminator (S. stipitis) (Other), TDH3 promoter (S. stipitis) (Other), coCherry, ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other) Robertson Jun 25, 2024
202770 pWR23 TEF1 promoter (S. stipitis) (Other), coKanMX (Synthetic), ACT1 terminator (S. stipitis) (Other), TDH3 promoter (S. stipitis) (Other), coCBG (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other) Robertson Jun 25, 2024
220350 MSCV-LMP1-IRES-GFP LMP1 (Other) Rajewsky Jun 25, 2024
220351 MSCV-LMP1-IRES-mCherry LMP1 (Other) Rajewsky Jun 25, 2024
220352 MSCV-LMP2A-IRES-GFP LMP2A (Other) Rajewsky Jun 25, 2024
220353 MSCV-LMP2A-IRES-mCherry LMP2A (Other) Rajewsky Jun 25, 2024
220354 MSCV-opEBNA2-IRES-GFP opEBNA2 (Other) Rajewsky Jun 25, 2024
220355 MSCV-opEBNA2-IRES-mCherry opEBNA2 (Other) Rajewsky Jun 25, 2024
202710 pWR10 TEF1 promoter (S. stipitis) (Other), coShBle (Synthetic), ACT1 terminator (S. stipitis) (Other), TDH3 promoter (S. stipitis) (Other), coCBG (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other) Robertson Jun 25, 2024
202645 pWR9 TEF1 promoter (S. stipitis) (Other), coHPH (Synthetic), ACT1 terminator (S. stipitis) (Other), TDH3 promoter (S. stipitis) (Other), coCBG (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other) Robertson Jun 25, 2024
217611 ZIF-NLS-EGFP*-HOTag6-T2A-CEL-EGFP-YAP ZIF-NLS-EGFP*-HOTag6-T2A-CEL-EGFP-YAP (Homo sapiens) Shu Jun 25, 2024
131683 pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH EGFP-KASH (Synthetic), SpCas9 sgRNA vs mouse GRID1 (Mus musculus) Richie Jun 25, 2024
131684 pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH EGFP-KASH (Synthetic), SpCas9 sgRNA vs mouse GRID1 (Mus musculus) Richie Jun 25, 2024
195018 pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs CCGTATAGGCGGCTGCCCAA (Mus musculus), EGFP-KASH (Synthetic), TTCCGTGGTGGGCAACGTAG (Mus musculus) Richie Jun 25, 2024
131682 pOTTC1553 - pAAV EF1a EGFP-KASH EGFP-KASH (Synthetic) Richie Jun 25, 2024
207815 p663-UBC-miniTurbo-V5-NRF3 miniTurbo-V5-NRF3 (Homo sapiens) Major Jun 25, 2024
213497 pCC1R pcaU, nahR, rpaR, phlF, cinR, vanR, aiiA Isalan Jun 25, 2024
216518 pYES2/NTA/Leu-LegA7 Leg A7 (Other) Isberg Jun 25, 2024
216519 pYES2/NTA/Leu-LegA7Δank LegA7 ΔAnk (Other) Isberg Jun 25, 2024
216520 pYES2/NTA/Leu-LegA7ΔAnk290 LegA7 ΔAnk290 (Other) Isberg Jun 25, 2024
216521 pYES2/NTA/Leu-LegA7ΔNAnk264 LegA7 ΔNAnk264 (Other) Isberg Jun 25, 2024
216522 pYES2/NTA/Leu-LegA7ΔNAnk290 LegA7 ΔNAnk290 (Other) Isberg Jun 25, 2024
216365 pDG04439 xhNup133-Nb2t (+2Cys) Görlich Jun 25, 2024
216366 pTP489 xNup155-Nb1t (+3Cys) Görlich Jun 25, 2024
216367 pMSC263 xhNup155-Nb2i Görlich Jun 25, 2024
216368 pMSC236 xhNup155-Nb2i (+2Cys) Görlich Jun 25, 2024