pAAV-CMV-dSa VP64 Neurog2
(Plasmid #99695)

• Purpose: Expresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAV
• Depositing Lab: George Church
• Publication: Vora et al bioRxiv 2018. 298620

Backbone

• Vector backbone: pAAV (pUC f1)
• Vector type: AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG)
• Species: M. musculus (mouse), Synthetic
• Mutation: dead Cas9
• Entrez Gene: Neurog2 (a.k.a. Atoh4, Math4A, bHLHa8, ngn-2, ngn2)
• Tag / Fusion Protein:
  • VP64 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.