pGFP-ATIC
(Plasmid #99110)

• Purpose: Expresses human GFP-ATIC fusion in mammalian cells
• Depositing Lab: Stephen Benkovic
• Publication: An et al Science. 2008 Apr 4;320(5872):103-6. doi: 10.1126/science.1152241.

Backbone

• Vector backbone: pCI-neo
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 5472
• Total vector size (bp): 7974
• Modifications to backbone: none
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ATIC
• Alt name: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
• Species: H. sapiens (human)
• Insert Size (bp): 1779
• Mutation: S65T mutation in GFP gene
• GenBank ID: NM_004044
• Entrez Gene: ATIC (a.k.a. AICAR, AICARFT, HEL-S-70p, IMPCHASE, PURH)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry