Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPPAT-EGFP
(Plasmid #99105)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99105 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 6261
  • Modifications to backbone
    A206K, L221K, and F223R mutations in EGFP gene to minimize dimerization
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PPAT
  • Alt name
    phosphoribosyl pyrophosphate amidotransferase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1551
  • GenBank ID
    NM_002703
  • Entrez Gene
    PPAT (a.k.a. ATASE, GPAT, PRAT)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (enhanced green fluorescent protein) (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPPAT-EGFP was a gift from Stephen Benkovic (Addgene plasmid # 99105 ; http://n2t.net/addgene:99105 ; RRID:Addgene_99105)
  • For your References section:

    Reversible compartmentalization of de novo purine biosynthetic complexes in living cells. An S, Kumar R, Sheets ED, Benkovic SJ. Science. 2008 Apr 4;320(5872):103-6. doi: 10.1126/science.1152241. 10.1126/science.1152241 PubMed 18388293