-
PurposeExpresses human ADSL-EGFP fusion in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 6165
-
Modifications to backboneA206K, L221K, and F223R mutations in EGFP gene to minimize dimerization
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameADSL
-
Alt nameASL
-
Alt nameadenylosuccinate lyase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1452
-
GenBank IDNM_000026
-
Entrez GeneADSL (a.k.a. AMPS, ASASE, ASL)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (enhanced green fluorescent protein) (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pADSL-EGFP was a gift from Stephen Benkovic (Addgene plasmid # 99109 ; http://n2t.net/addgene:99109 ; RRID:Addgene_99109) -
For your References section:
Reversible compartmentalization of de novo purine biosynthetic complexes in living cells. An S, Kumar R, Sheets ED, Benkovic SJ. Science. 2008 Apr 4;320(5872):103-6. doi: 10.1126/science.1152241. 10.1126/science.1152241 PubMed 18388293