pPAICS-EGFP
(Plasmid #99108)

• Purpose: Expresses human PAICS-EGFP fusion in mammalian cells
• Depositing Lab: Stephen Benkovic
• Publication: An et al Science. 2008 Apr 4;320(5872):103-6. doi: 10.1126/science.1152241.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 5977
• Modifications to backbone: A206K, L221K, and F223R mutations in EGFP gene to minimize dimerization
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PAICS
• Alt name: phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase
• Species: H. sapiens (human)
• Insert Size (bp): 1275
• GenBank ID: NM_006452
• Entrez Gene: PAICS (a.k.a. ADE2, ADE2H1, AIRC, PAICSD, PAIS)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (enhanced green fluorescent protein) (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry