Skip to main content
Addgene

pAAV-CamKII-ArchT-GFP (PV2527)
(Plasmid #99039)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99039 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 99039-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405
AAV5 99039-AAV5 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
AAV9 99039-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) $405
AAV Retrograde 99039-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV with CaMKII promoter
  • Backbone manufacturer
    Scott Sternson
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ArchT-GFP
  • Alt name
    archaerhodopsin
  • Alt name
    archaerhodopsin TP009
  • Insert Size (bp)
    1476
  • Promoter CamKII
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaggctgtgagcagccacag
  • 3′ sequencing primer aaagagacagcaaccagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for AAV1 (Catalog # 99039-AAV1) ( Back to top)

Purpose

Ready-to-use AAV1 particles produced from pAAV-CamKII-ArchT-GFP (PV2527) (#99039). In addition to the viral particles, you will also receive purified pAAV-CamKII-ArchT-GFP (PV2527) plasmid DNA.

CaMKII-driven ArchT-GFP expression for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Data submitted about 99039-AAV1 by requesting scientist(s):

Information for AAV5 (Catalog # 99039-AAV5) ( Back to top)

Purpose

Ready-to-use AAV5 particles produced from pAAV-CamKII-ArchT-GFP (PV2527) (#99039). In addition to the viral particles, you will also receive purified pAAV-CamKII-ArchT-GFP (PV2527) plasmid DNA.

CaMKII-driven ArchT-GFP expression for optogenetic inhibition.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV9 (Catalog # 99039-AAV9) ( Back to top)

Purpose

Ready-to-use AAV9 particles produced from pAAV-CamKII-ArchT-GFP (PV2527) (#99039). In addition to the viral particles, you will also receive purified pAAV-CamKII-ArchT-GFP (PV2527) plasmid DNA.

CaMKII-driven ArchT-GFP expression for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 99039-AAVrg) ( Back to top)

Purpose

Ready-to-use AAV Retrograde particles produced from pAAV-CamKII-ArchT-GFP (PV2527) (#99039). In addition to the viral particles, you will also receive purified pAAV-CamKII-ArchT-GFP (PV2527) plasmid DNA.

CaMKII-driven ArchT-GFP expression for optogenetic inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CamKII-ArchT-GFP (PV2527) was a gift from Edward Boyden (Addgene plasmid # 99039 ; http://n2t.net/addgene:99039 ; RRID:Addgene_99039) For viral preps, please replace (Addgene plasmid # 99039) in the above sentence with: (Addgene viral prep # 99039-AAV1), (Addgene viral prep # 99039-AAV5), (Addgene viral prep # 99039-AAV9), or (Addgene viral prep # 99039-AAVrg)
  • For your References section:

    A high-light sensitivity optical neural silencer: development and application to optogenetic control of non-human primate cortex. Han X, Chow BY, Zhou H, Klapoetke NC, Chuong A, Rajimehr R, Yang A, Baratta MV, Winkle J, Desimone R, Boyden ES. Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13. 10.3389/fnsys.2011.00018 PubMed 21811444